ID: 1190865346

View in Genome Browser
Species Human (GRCh38)
Location X:54379968-54379990
Sequence GTCCCAATGCTTGAACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190865343_1190865346 0 Left 1190865343 X:54379945-54379967 CCTAGGATAGAGGGTTAGCCCAA No data
Right 1190865346 X:54379968-54379990 GTCCCAATGCTTGAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190865346 Original CRISPR GTCCCAATGCTTGAACTCAC AGG Intergenic
No off target data available for this crispr