ID: 1190866398

View in Genome Browser
Species Human (GRCh38)
Location X:54388453-54388475
Sequence CTGTCACCTCATTAGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190866398_1190866400 -1 Left 1190866398 X:54388453-54388475 CCACAAGGCTAATGAGGTGACAG No data
Right 1190866400 X:54388475-54388497 GACAATACCTAAAGCAGGCCAGG No data
1190866398_1190866403 7 Left 1190866398 X:54388453-54388475 CCACAAGGCTAATGAGGTGACAG No data
Right 1190866403 X:54388483-54388505 CTAAAGCAGGCCAGGAGTGGTGG 0: 2
1: 4
2: 37
3: 444
4: 2901
1190866398_1190866401 4 Left 1190866398 X:54388453-54388475 CCACAAGGCTAATGAGGTGACAG No data
Right 1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG No data
1190866398_1190866399 -6 Left 1190866398 X:54388453-54388475 CCACAAGGCTAATGAGGTGACAG No data
Right 1190866399 X:54388470-54388492 TGACAGACAATACCTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190866398 Original CRISPR CTGTCACCTCATTAGCCTTG TGG (reversed) Intergenic
No off target data available for this crispr