ID: 1190866401

View in Genome Browser
Species Human (GRCh38)
Location X:54388480-54388502
Sequence TACCTAAAGCAGGCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190866397_1190866401 9 Left 1190866397 X:54388448-54388470 CCAATCCACAAGGCTAATGAGGT No data
Right 1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG No data
1190866398_1190866401 4 Left 1190866398 X:54388453-54388475 CCACAAGGCTAATGAGGTGACAG No data
Right 1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190866401 Original CRISPR TACCTAAAGCAGGCCAGGAG TGG Intergenic
No off target data available for this crispr