ID: 1190870279

View in Genome Browser
Species Human (GRCh38)
Location X:54419164-54419186
Sequence CAGGAAATAAAGGGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190870279_1190870282 -10 Left 1190870279 X:54419164-54419186 CCTGCAGCTCCCTTTATTTCCTG No data
Right 1190870282 X:54419177-54419199 TTATTTCCTGCCCAGTCTGAAGG No data
1190870279_1190870287 13 Left 1190870279 X:54419164-54419186 CCTGCAGCTCCCTTTATTTCCTG No data
Right 1190870287 X:54419200-54419222 CTGCTCCTCCAGCCACACATGGG No data
1190870279_1190870286 12 Left 1190870279 X:54419164-54419186 CCTGCAGCTCCCTTTATTTCCTG No data
Right 1190870286 X:54419199-54419221 GCTGCTCCTCCAGCCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190870279 Original CRISPR CAGGAAATAAAGGGAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr