ID: 1190873888

View in Genome Browser
Species Human (GRCh38)
Location X:54446230-54446252
Sequence GTGCTTGGCCGGGCGGGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190873888_1190873896 13 Left 1190873888 X:54446230-54446252 CCTCGGCCCGCCCGGCCAAGCAC 0: 1
1: 0
2: 0
3: 23
4: 229
Right 1190873896 X:54446266-54446288 CGCTGTAGTTCCTCTGTCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 97
1190873888_1190873897 14 Left 1190873888 X:54446230-54446252 CCTCGGCCCGCCCGGCCAAGCAC 0: 1
1: 0
2: 0
3: 23
4: 229
Right 1190873897 X:54446267-54446289 GCTGTAGTTCCTCTGTCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190873888 Original CRISPR GTGCTTGGCCGGGCGGGCCG AGG (reversed) Exonic
900102294 1:967024-967046 GAGCTGGGCGGGGCGGGCCGCGG + Intronic
900155883 1:1203122-1203144 GTGGGAGGCTGGGCGGGCCGAGG + Intergenic
901242818 1:7704795-7704817 GGGCTGGGCCGGGCCGGGCGGGG + Intronic
901242826 1:7704810-7704832 GGGCGGGGCCGGGCGGGGCGCGG + Intronic
901791301 1:11654845-11654867 GGGCGGGGCCTGGCGGGCCGGGG + Exonic
902336083 1:15755835-15755857 GTGCTAGGCAGGGCGGGGAGAGG - Intergenic
902586198 1:17439816-17439838 GGGCCAGGCCGGGCGGGGCGGGG - Intergenic
903324781 1:22563609-22563631 GGGCCGGGCCGGGCGGGCGGGGG - Exonic
903931640 1:26865465-26865487 GGCCTGGGCCGGGCCGGCCGCGG + Intergenic
904039513 1:27575851-27575873 GGGCCCGGCCTGGCGGGCCGGGG - Intronic
904457466 1:30656329-30656351 GTGCTAAGCCGGGAGGGGCGGGG - Intergenic
904697038 1:32336450-32336472 GAGCTGGGCGGGGCGGGGCGGGG + Intergenic
904775082 1:32901420-32901442 CTGCGGGGCCGGGCGGCCCGGGG - Intronic
905016452 1:34781783-34781805 GTGCTGGACGGGGCGGGGCGAGG + Intronic
905174055 1:36125293-36125315 GCGCTGGGCCGGGCGGGGCGCGG - Intergenic
906680937 1:47725149-47725171 GCGCATGGCCGGCCGCGCCGGGG + Intergenic
909475222 1:76074639-76074661 GGGCGGGGCCGCGCGGGCCGCGG + Intergenic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
919451153 1:197775008-197775030 GAGGTTGGCCGGGCGGGCTGGGG - Intronic
920378619 1:205522893-205522915 GGGCGTGGCGGGGCGGGCGGTGG + Intronic
920641169 1:207752796-207752818 GTGCTGGGCTGGGCGAGCAGGGG + Intronic
921167141 1:212515252-212515274 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
922929491 1:229377594-229377616 TTGGTTGGCCAGGCGGGCAGAGG - Intergenic
1063393606 10:5666363-5666385 GCGTTTGGCGGGGTGGGCCGCGG - Intronic
1063418308 10:5890501-5890523 GGGCTCGGCCGTCCGGGCCGTGG + Intronic
1063464900 10:6236781-6236803 GTCCTGGGCCGGCCGGGCTGTGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067110466 10:43396741-43396763 CTGCCGGGCCGGGCGGTCCGAGG - Exonic
1067667067 10:48287882-48287904 GTGCTTGGCAGGACAGGCCTGGG + Intergenic
1068544930 10:58334914-58334936 GTGCCAGGCGGGGCGGGGCGCGG + Intergenic
1070153321 10:73818556-73818578 GTGCTGGCCCGGCTGGGCCGTGG - Intronic
1070752809 10:78973956-78973978 GGGCTGGGCCGGGCGGGGCCGGG - Intergenic
1075106509 10:119543057-119543079 AAGCTGGGCGGGGCGGGCCGGGG - Intergenic
1076715072 10:132359535-132359557 GGGCTGGGCTGGGCGGGCCTGGG + Intronic
1076802345 10:132836381-132836403 GTGCATGGCCGGTCAGGACGTGG + Intronic
1076875068 10:133211729-133211751 GGGCATGGACCGGCGGGCCGAGG + Exonic
1077008442 11:369703-369725 GAGCGCGGCGGGGCGGGCCGGGG + Intergenic
1080045782 11:27806312-27806334 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
1082657797 11:55873293-55873315 GTGCGTGGCCCGGAGGACCGGGG - Intergenic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083669510 11:64292192-64292214 GCGCTTGGCGGCGCGTGCCGGGG + Intronic
1086697726 11:89864291-89864313 GTGCGTGGCCCGGAGGACCGGGG - Intergenic
1086708435 11:89980197-89980219 GTGCGTGGCCCGGAGGACCGGGG + Intergenic
1091604280 12:1936861-1936883 GTGCGTGGCCGCGCAGGCTGGGG - Intergenic
1091869186 12:3873189-3873211 GTGAGTAGCCGGGCGGGACGGGG - Intronic
1092136804 12:6155178-6155200 GTGCCTGGCCTGGCCGGCCTCGG - Intergenic
1094041800 12:26126521-26126543 GTGCCCGGCGGGGCGGGCCGGGG - Intronic
1095949302 12:47773278-47773300 CTGCGGCGCCGGGCGGGCCGAGG - Exonic
1103595588 12:122022693-122022715 GCGGGCGGCCGGGCGGGCCGGGG - Intronic
1104568303 12:129903962-129903984 GCCCGGGGCCGGGCGGGCCGAGG - Intergenic
1104697181 12:130872260-130872282 GTGCGGGCCCGGCCGGGCCGGGG + Intronic
1104854310 12:131894909-131894931 GGGCCGGGGCGGGCGGGCCGGGG - Exonic
1105413816 13:20192747-20192769 GTTCCTGGCCGGGCAGTCCGGGG + Intronic
1108662641 13:52600445-52600467 GGGCTGGGCTGGGCGCGCCGCGG - Intergenic
1109917595 13:69011909-69011931 ATGTTTGGCCGGGCCGGGCGCGG - Intergenic
1110195251 13:72781582-72781604 GTGCGTGGGCGGGCGAACCGCGG - Intronic
1112319737 13:98395452-98395474 GTGCTTGGCTGCGGGGGCTGAGG - Exonic
1113813153 13:113154186-113154208 GGGCGTGGGGGGGCGGGCCGTGG + Intergenic
1113813170 13:113154217-113154239 GGGCGTGGGGGGGCGGGCCGTGG + Intergenic
1113814029 13:113159346-113159368 GTGCTGGGCAGGGCAGGGCGGGG - Intronic
1113851699 13:113421576-113421598 GTGGTTGGCGGGGCTGGCCCGGG + Intergenic
1116018365 14:39432578-39432600 GGGCTGGGCGGGGCGGGGCGGGG + Intergenic
1118206498 14:63728101-63728123 GGGCTGGGCGGGGCGGGGCGCGG - Intergenic
1118293735 14:64549876-64549898 GTCCTAGGCCGCGCGGGCTGCGG - Intergenic
1122418321 14:101560781-101560803 GTGCGTGGCGGGGCGGTGCGGGG + Intergenic
1122904427 14:104795398-104795420 GTTCGCGGCCGGTCGGGCCGGGG - Intronic
1122980052 14:105187359-105187381 GTGCTTGGCAGGGAGAGCCTGGG + Intergenic
1123464705 15:20506451-20506473 CTGCTTGGCCCGGAGCGCCGCGG + Intergenic
1127433431 15:58933790-58933812 GCGCTCGGTCGAGCGGGCCGCGG + Intronic
1129253462 15:74320934-74320956 GAGCTTGGCTGGGTGGGCAGTGG + Intronic
1129263512 15:74382081-74382103 GTGCTGGGCCTGGCTGGCTGAGG - Intergenic
1131049038 15:89334464-89334486 GCTCTCGGCCGGGTGGGCCGTGG - Intronic
1131076225 15:89496554-89496576 GTGCCTGGCCGGGCTGGCAGCGG + Exonic
1132163973 15:99566453-99566475 GGGCTCGGCTGGGCGGGCCGAGG + Intronic
1132480661 16:164867-164889 GGGCTGGGCGGGGCGGGGCGCGG + Intronic
1132623647 16:879851-879873 GTGCAGGGCCAGGCGGGCCGGGG - Intronic
1132815940 16:1826654-1826676 GGGCCTGGCGGGGCGGGCAGCGG - Intronic
1133079162 16:3305145-3305167 GAGCACGGCCGGCCGGGCCGCGG + Intronic
1133272363 16:4616440-4616462 GCGCTGGGCCGGGGAGGCCGGGG + Intergenic
1134107937 16:11497396-11497418 GGGCTTGGCTGGGAGGGCAGGGG + Intronic
1136283862 16:29230153-29230175 GTGCTTGGCTGGGGGGACAGGGG + Intergenic
1136402274 16:30025186-30025208 GTCCTGGGCCTGGCAGGCCGGGG + Exonic
1137938611 16:52658842-52658864 GTGTTTGGCAGGGTGGGCTGTGG - Intergenic
1138360674 16:56425134-56425156 GCGCTCGGCCGGGCGGGCGCCGG + Exonic
1138506054 16:57478870-57478892 GTGGTTGGCTGGGCGAGACGGGG - Intronic
1139544820 16:67645229-67645251 GCCATGGGCCGGGCGGGCCGGGG - Exonic
1139548537 16:67661017-67661039 TGGCGGGGCCGGGCGGGCCGGGG - Exonic
1140275469 16:73504803-73504825 GTGCTTGGTTGGGGGGGCGGTGG + Intergenic
1140478794 16:75251644-75251666 GGGCTGGGCCGGCTGGGCCGTGG - Intronic
1141025293 16:80541099-80541121 GTGCTTGGAACGGCGGGGCGTGG - Intronic
1141573463 16:84948644-84948666 GTGCCCGGCCGGGCGGGCTTTGG - Intergenic
1142153695 16:88523719-88523741 GTGTTTGGCAGTGGGGGCCGTGG + Intronic
1142683318 17:1562585-1562607 GCGGGAGGCCGGGCGGGCCGCGG - Exonic
1142978959 17:3660553-3660575 GTGCCTGGCCGGGGAGGCCCAGG - Intronic
1143503493 17:7351851-7351873 GGGCTGGGCCGGCCGGGCCTCGG + Intergenic
1143676363 17:8435974-8435996 GGGCCTGGCCGGGCCGGCGGAGG + Exonic
1145273195 17:21415347-21415369 GGGGTTGGCCCGGCTGGCCGCGG - Exonic
1145311388 17:21702791-21702813 GGGGTTGGCCCGGCTGGCCGCGG - Exonic
1146393641 17:32444636-32444658 GAGCTGGGCCGGCGGGGCCGGGG - Intronic
1146445343 17:32928249-32928271 CCGCCGGGCCGGGCGGGCCGCGG + Intronic
1147258994 17:39197728-39197750 GGGCGGGGCCGGGCGGGCGGAGG - Intergenic
1148860047 17:50600012-50600034 GGGCTTGGCAAGGCGGGCAGAGG - Intronic
1149495042 17:57112146-57112168 GTGCTTGGTTGGGCGGGGCCTGG + Intronic
1149665892 17:58364583-58364605 GTGCTAGGCCGGGAGGCCCCAGG - Intronic
1149694979 17:58609653-58609675 GTGCTTGGCCTTGTGGGCCCTGG - Intronic
1151332082 17:73415967-73415989 CTGCCTGGCCGGGCTGCCCGTGG - Exonic
1152565252 17:81097472-81097494 GTGCCGGGCCGGGTGGGCGGCGG - Intronic
1152628686 17:81399922-81399944 GTGCTCGGCCGGGGCGGGCGCGG + Intronic
1152628892 17:81400770-81400792 GTCCTTGGCAGAGCGGGCCCAGG + Intronic
1152636991 17:81434293-81434315 GCGCCTGGCTGGGCGGGCAGTGG - Intronic
1152718552 17:81911408-81911430 GCGCCTGGCGGGGCGGGCGGCGG - Intronic
1152861576 17:82699145-82699167 GTGCCTGGCCGGGTGGGGCTCGG + Intergenic
1152908271 17:82982192-82982214 GTGATGGGCCGAGCGGGCCGAGG + Intronic
1155507791 18:26549040-26549062 CGGCTGCGCCGGGCGGGCCGCGG + Exonic
1155990261 18:32272579-32272601 ATGCTTGGCTGGGCTGGCCCAGG + Intronic
1156448760 18:37254540-37254562 GAGCCTGGCGGGGCGGGCAGAGG - Intronic
1160517480 18:79486585-79486607 GTGGCTGCCCGGGCGAGCCGGGG - Exonic
1160752336 19:740304-740326 GTGCGGGGGCGGGCAGGCCGTGG + Intronic
1160947798 19:1651805-1651827 GGTCGGGGCCGGGCGGGCCGGGG - Intronic
1161027210 19:2042224-2042246 GTGTTTGGCCGGGTGGGGCGGGG - Intronic
1161115615 19:2495036-2495058 GAGCTGGCCCGGGCGGGACGGGG + Intergenic
1161285088 19:3464521-3464543 GGGCTGGGCTGGGTGGGCCGGGG - Intronic
1161422000 19:4181107-4181129 GTGCAGGGCCTGGTGGGCCGTGG - Intronic
1161851369 19:6739631-6739653 GGGCGGGGCCGGGCGGGGCGGGG + Intronic
1162392018 19:10395596-10395618 GAGCGCGGCCGGGCGGGCCGTGG + Intronic
1162971234 19:14182642-14182664 GGGCTTGGGAGGGAGGGCCGGGG + Intronic
1163348380 19:16759375-16759397 CTACTTGGCCCGGCGGCCCGTGG + Exonic
1163407963 19:17135500-17135522 CTGCTTGGCTGGGCTGGCCGGGG - Intronic
1163662752 19:18588650-18588672 GGGCTTGACTGGGCGGCCCGCGG + Intronic
1164159633 19:22617973-22617995 GCGCTGGACCGGGAGGGCCGAGG - Intergenic
1164498699 19:28793661-28793683 GGGCTCGGCCGGGCGCGGCGGGG - Intergenic
1165922611 19:39308140-39308162 GTCCTGGGCCGGCAGGGCCGGGG + Exonic
1166721807 19:45001431-45001453 GGGCCGGGCCGGGCGGGCGGCGG - Exonic
1167080320 19:47273291-47273313 GTGCTGGGCCGGGGGGGAGGTGG + Intergenic
1167428439 19:49441476-49441498 CTGCGGGGCCGGCCGGGCCGGGG - Exonic
1168294160 19:55370497-55370519 GGGCTGGGGCGGGCGGGCGGGGG + Intergenic
1168308910 19:55451236-55451258 GGGCTGGGCCGGGCGGGCGCCGG + Intergenic
1168341353 19:55624683-55624705 GGGCGTGGCGGGGCGGGGCGTGG + Intergenic
926310317 2:11670092-11670114 GAGCTGGGCCGCGGGGGCCGCGG + Exonic
926739966 2:16102792-16102814 GTTCTTGGCTGGGAGGTCCGAGG + Intergenic
929778116 2:44941104-44941126 GACCTTGGCCCAGCGGGCCGTGG - Intergenic
933690377 2:85175075-85175097 GAGCTGCGCCGGGCGGGCCAGGG - Intronic
934594253 2:95590318-95590340 GTCCTTGGCCGCACGGACCGTGG - Intergenic
934993263 2:98936141-98936163 GCGCAGGGCCGGGCCGGCCGCGG - Exonic
935129110 2:100248061-100248083 GTGCTTGGGCAGGGGGGACGTGG - Intergenic
937238206 2:120443128-120443150 GTGCTGGGCGGGGCCGGCAGTGG - Intergenic
941089652 2:161160268-161160290 GCGCTAGGCGGGGCGGGCAGGGG + Intronic
947623625 2:231605793-231605815 GTGCTTGGCCTGTTGGGCTGGGG - Intergenic
948142626 2:235685065-235685087 GGGCTTTGCTGGGTGGGCCGAGG + Intronic
948402166 2:237692147-237692169 GTGGGGGGCGGGGCGGGCCGTGG + Intronic
1168769786 20:408003-408025 GGGCGGGGCCGGGGGGGCCGGGG - Intronic
1171189007 20:23145106-23145128 GAGCATGACCGGGCGGGCTGAGG + Intergenic
1173501653 20:43558429-43558451 GTGCTTGGTCGGGTAGGCTGTGG + Intronic
1174586790 20:51615083-51615105 GTGCCTGGGGGGGCGGGGCGGGG + Intronic
1175136377 20:56827412-56827434 GTCCCAGGCCGGGCGGGCGGGGG - Intergenic
1175700598 20:61134141-61134163 GTGCTGGTCCGGGAGGGCTGTGG - Intergenic
1175800412 20:61798175-61798197 GGGCAGGGCCGGGCGGGGCGGGG - Intronic
1175847223 20:62065331-62065353 GGGCTTGGCGGGGCCGGCGGGGG + Exonic
1176146349 20:63567216-63567238 GTGCTCGGCCGCCCGGGCCCTGG + Exonic
1176548978 21:8213457-8213479 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176550604 21:8219248-8219270 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176556871 21:8257669-8257691 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176567907 21:8396487-8396509 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176569534 21:8402289-8402311 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176575811 21:8440706-8440728 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176577446 21:8446518-8446540 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1179928114 21:44549804-44549826 GTGCTGGGCTGGGTGGGCGGAGG - Intronic
1179938059 21:44617404-44617426 GTGCTGGGCTGGGTGGGCGGAGG + Intronic
1180077239 21:45468982-45469004 GTTCTTGGCCGGCCTGGCTGGGG + Intronic
1180085389 21:45505789-45505811 GGGCTTGGCGGGGAGGGCGGGGG - Intronic
1180980973 22:19877811-19877833 GTGCTTGGCCAGGTGGGCAAGGG + Intronic
1181085538 22:20437824-20437846 GTGCGAGGCCGGGCGGGGGGCGG + Exonic
1182257640 22:29050100-29050122 GTGCTGGGCGGGGCGAGCCTTGG + Exonic
1182260953 22:29072981-29073003 GCGCTGAGCTGGGCGGGCCGGGG + Intergenic
1184745703 22:46454448-46454470 CTGCCTGGCCGGGCTGGCTGCGG - Intronic
1203253862 22_KI270733v1_random:129764-129786 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203255503 22_KI270733v1_random:135591-135613 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1203261918 22_KI270733v1_random:174843-174865 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
949414409 3:3799924-3799946 GTCCCTGGCCGGCCGCGCCGCGG + Intronic
950400951 3:12768894-12768916 GGGCGGGGCAGGGCGGGCCGGGG + Intronic
954615601 3:51967509-51967531 GGGCCGGGCCGGGCGGGCCGGGG - Intronic
961377365 3:126475784-126475806 GGGCTCGGCGGAGCGGGCCGGGG + Exonic
961446342 3:126983351-126983373 GTCCGGGGCCGGGCGGCCCGTGG + Intergenic
961665859 3:128492830-128492852 GTGCCAGGCGGGCCGGGCCGGGG + Intronic
961760075 3:129160921-129160943 GTGGATGGGCGGGCGGGCGGGGG - Intronic
962444592 3:135453185-135453207 GTACCTGGCAGGGCTGGCCGCGG + Intergenic
964801578 3:160564861-160564883 GTGCTGCCCCGGCCGGGCCGCGG - Intronic
966849381 3:184155372-184155394 GCCCTGGGCCGGGAGGGCCGCGG + Exonic
968965120 4:3765838-3765860 GCGCGGGGCGGGGCGGGCCGCGG - Intergenic
968981533 4:3852582-3852604 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
969516413 4:7650716-7650738 GGGCTGGGCTGGGCGGGGCGGGG - Intronic
969524980 4:7699745-7699767 GTGCATGGCCAGGCGGGTGGCGG - Intronic
970585687 4:17512112-17512134 GGGGTTGGCCGGCCGGGGCGGGG - Exonic
976236322 4:82900919-82900941 CTGCGGGGCCCGGCGGGCCGTGG + Intronic
980795797 4:137681044-137681066 GTGCTTGGCCAGCAGGGCAGTGG + Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
987132432 5:14871902-14871924 GGGCCGGGCCGGGCGCGCCGCGG + Intergenic
988450505 5:31338027-31338049 GTCCTTGGTCGGGCCGGGCGTGG + Intergenic
992124632 5:73627136-73627158 TTGGTTGGCTGGGTGGGCCGAGG + Intronic
999450760 5:151676140-151676162 TTGCCTGGCCGGGAGGGCCTTGG - Exonic
1001617765 5:173056629-173056651 GTGCTAGGGCGCGCGGGCCTTGG + Intronic
1002524526 5:179807572-179807594 GGGCTGGGCTGGGCGGGGCGAGG - Intronic
1003624298 6:7727845-7727867 GCGGCTGGCCGGCCGGGCCGCGG + Intronic
1004044395 6:12011627-12011649 CGGCTCGGCCGGGCGGGGCGGGG + Intronic
1006317070 6:33297533-33297555 GTCCTTGGCCGGGAGGGGCGGGG - Intronic
1006642518 6:35496582-35496604 GTGCTTGGGGGGTCGGGGCGGGG - Intronic
1006932609 6:37697048-37697070 CTGCTGTGCCGGGCGCGCCGAGG - Exonic
1011633939 6:89352986-89353008 CGGCTTCGCCGGGCGGGCGGCGG - Intergenic
1014632465 6:123803663-123803685 TTGCTGGGCCCGGCGGGCGGGGG - Intergenic
1015366251 6:132401124-132401146 GGGCTCGGCCGGGCGGGCTCCGG + Intronic
1017446618 6:154511783-154511805 TTGCTGGGCGGGGCGGGGCGGGG - Intergenic
1019931336 7:4225354-4225376 GTGCTTGTCCGAGCAGGCTGGGG - Intronic
1023972310 7:45000294-45000316 GGGGCGGGCCGGGCGGGCCGCGG + Intronic
1026649119 7:72199457-72199479 GTGCTTGGCAGGCTGAGCCGGGG + Intronic
1026775723 7:73229879-73229901 GTGCATGGCAGGCCGGGGCGGGG + Intergenic
1027016580 7:74783251-74783273 GTGCATGGCAGGCCGGGGCGGGG + Intronic
1027071448 7:75162685-75162707 GTGCATGGCAGGCCGGGGCGGGG - Intergenic
1027218924 7:76201943-76201965 GTGCGGGGCCGTGGGGGCCGCGG + Exonic
1034219975 7:149436548-149436570 GTGCTGGGCGGGGACGGCCGGGG - Intronic
1034228036 7:149497866-149497888 GGGCTGGGCGGGGCGGGGCGGGG - Intergenic
1034418644 7:150977952-150977974 GTGCTGGGCCGGGCCGGGCCGGG - Exonic
1034437979 7:151072156-151072178 GAGCTGGGCCAGGAGGGCCGAGG + Intronic
1034522530 7:151632011-151632033 GTCCTCGGGCGGCCGGGCCGTGG + Intronic
1036391137 8:8325223-8325245 GTCATTGGGGGGGCGGGCCGTGG - Intronic
1039973258 8:42338420-42338442 GTCCTGGGCGGGGCGGGGCGGGG - Intergenic
1048360056 8:133689899-133689921 GTGCTTGGCCTGGCAGGATGAGG + Intergenic
1049826414 8:144671692-144671714 GTGGCTGGCCGGGAGGGGCGTGG - Intergenic
1052494931 9:29213470-29213492 GTGCGGGGCTGGGCGGGCGGCGG + Intergenic
1056579534 9:87880776-87880798 GTGGTTGGCGGGGCGGGGGGGGG + Intergenic
1057758510 9:97854714-97854736 GGGGTTGGCCGGCCGGGCCCCGG - Exonic
1058908530 9:109499844-109499866 GGGCCGGGCCGGGCGGGGCGCGG - Intergenic
1059102592 9:111484234-111484256 GGGCTGGGCCGAGCGGGCCCGGG + Exonic
1060408031 9:123382290-123382312 GAGCTTGGCCGGGCGGGGAATGG + Exonic
1060827681 9:126696017-126696039 GTGCTGGGGCGGGCGGGTGGGGG - Intronic
1061144097 9:128787177-128787199 GTGACTGGCGGGGCGGGGCGGGG + Intergenic
1062165571 9:135105732-135105754 GGGCTTGGCCGGGAGGGACAGGG + Intronic
1062272152 9:135714494-135714516 GGGCCGGGCCTGGCGGGCCGGGG + Intronic
1062467440 9:136687453-136687475 GGGCTGGGCGGGGCGGGGCGCGG + Intergenic
1062584215 9:137241685-137241707 GGGCGGGCCCGGGCGGGCCGGGG - Intronic
1203470262 Un_GL000220v1:112908-112930 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203471899 Un_GL000220v1:118726-118748 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1203478083 Un_GL000220v1:156880-156902 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1187826030 X:23334298-23334320 GAGCTTGGCGGGCCGGACCGGGG + Exonic
1189318576 X:40073522-40073544 GTGCTTGGCAGGAGTGGCCGGGG + Exonic
1190303043 X:49067471-49067493 GAGCTAGGCCGGGCGGCCCGGGG - Exonic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1192212499 X:69136867-69136889 GTGCTTGGGCTGGCTAGCCGCGG + Intergenic
1198005603 X:132489768-132489790 CTACCTGGCCGGGCGGGGCGGGG - Intronic
1198205335 X:134460123-134460145 GGGCGTGGCGGGGCGGGCAGAGG + Intergenic
1198398843 X:136250966-136250988 CTGCTTCGACGGGCGGGGCGGGG - Intronic
1198849816 X:140954484-140954506 GTCTTTGGCCGGGCTGGACGTGG + Intergenic
1200141691 X:153905749-153905771 GTGCCTGGCCGACCTGGCCGTGG + Exonic
1200179780 X:154143373-154143395 GCGCTGGGGCGGGTGGGCCGTGG + Intergenic