ID: 1190876191

View in Genome Browser
Species Human (GRCh38)
Location X:54461947-54461969
Sequence CAGTGAGAGCCTTCAGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190876191_1190876202 23 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876202 X:54461993-54462015 GTGGGAAGAGTATTCCAGGTGGG 0: 1
1: 0
2: 7
3: 47
4: 318
1190876191_1190876201 22 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876201 X:54461992-54462014 TGTGGGAAGAGTATTCCAGGTGG 0: 1
1: 1
2: 13
3: 66
4: 371
1190876191_1190876200 19 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876200 X:54461989-54462011 CAGTGTGGGAAGAGTATTCCAGG 0: 1
1: 0
2: 5
3: 34
4: 285
1190876191_1190876194 -7 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876194 X:54461963-54461985 CTCACTGGGAACCCACTCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 173
1190876191_1190876203 29 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876203 X:54461999-54462021 AGAGTATTCCAGGTGGGAAGAGG 0: 1
1: 1
2: 3
3: 39
4: 260
1190876191_1190876197 4 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876197 X:54461974-54461996 CCCACTCTCAGGGCTCAGTGTGG 0: 1
1: 1
2: 1
3: 27
4: 254
1190876191_1190876199 5 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876199 X:54461975-54461997 CCACTCTCAGGGCTCAGTGTGGG 0: 1
1: 0
2: 4
3: 27
4: 295
1190876191_1190876195 -6 Left 1190876191 X:54461947-54461969 CCTCAAGCTGAAGGCTCTCACTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1190876195 X:54461964-54461986 TCACTGGGAACCCACTCTCAGGG 0: 1
1: 0
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190876191 Original CRISPR CAGTGAGAGCCTTCAGCTTG AGG (reversed) Intronic
900618036 1:3574068-3574090 CACTGAGGGCCTCCTGCTTGAGG + Intronic
904116231 1:28163951-28163973 CAGGCACAGCCTTCAGCTGGGGG + Intronic
904206814 1:28860924-28860946 CACTGTCAGCCTTCAGCTTACGG + Intronic
905106059 1:35564305-35564327 CAGTGACAGCCTTCAGCACTTGG + Intronic
905853279 1:41290110-41290132 CAGGGAGAGCGTGCAGCTGGAGG + Intergenic
907414672 1:54306036-54306058 GAGGGAGAACCTTCAGCTGGGGG - Intronic
907785990 1:57613349-57613371 CACTGAGAGCCTACAGCAGGTGG + Intronic
910530866 1:88234011-88234033 CTGTTAGAGCCTTAAGCTGGAGG - Intergenic
910612052 1:89155123-89155145 CAGTCAGGGCCTTCAGCTGCAGG - Intronic
911275544 1:95853728-95853750 CAGGGAGAGCCTAAAGCCTGGGG + Intergenic
915008500 1:152663164-152663186 CAGTCAGAGCCTCCAGCAGGTGG - Intergenic
917536421 1:175877658-175877680 CAGTGACAGCCTTAAAGTTGTGG - Intergenic
917702069 1:177591506-177591528 CAGTAAGAGCCTGCAGCTTTCGG - Intergenic
919435326 1:197551927-197551949 CATTGAAAGCATTTAGCTTGGGG - Intronic
922729200 1:227941217-227941239 CAGGGAGAGCCTCAGGCTTGAGG + Intronic
923676097 1:236081925-236081947 CAGGGAGATCCTTCAGCCTTGGG - Intergenic
1065521637 10:26579533-26579555 CAGTGGGTGCCTTCAGTTGGTGG + Intergenic
1065559097 10:26944384-26944406 CAGTGGGTGCCTTCAGTTGGTGG - Intergenic
1065559378 10:26946591-26946613 CAGTGGGTGCCTTCAGTTGGTGG - Intergenic
1067571011 10:47370925-47370947 CACTGAGAGCATGCAGCATGCGG + Intronic
1068406414 10:56595380-56595402 AACTGACAGCCTTCAGTTTGTGG + Intergenic
1068495434 10:57779731-57779753 CAGTCAGACCCTTCAGCTGCAGG - Intergenic
1068933916 10:62617836-62617858 CAGTGACAGCTGACAGCTTGTGG + Intronic
1070852929 10:79582646-79582668 CAGTGTAAGCCTTCTCCTTGGGG - Intergenic
1070888151 10:79922659-79922681 CAGTGTAAGCCTTCTCCTTGGGG + Intergenic
1073210351 10:101796276-101796298 CAGAGCGAGACTTCATCTTGTGG - Intronic
1073773822 10:106764422-106764444 CAGGGAAAGCCTTCCGCTGGTGG - Intronic
1074705169 10:116123809-116123831 CAGTGACTGCCTGAAGCTTGGGG + Intronic
1075703998 10:124488061-124488083 CACTGAGAGCCTGCAGCAGGAGG - Intronic
1076263380 10:129090084-129090106 CAGTGAGAGGCCTCTGTTTGGGG + Intergenic
1076909580 10:133380177-133380199 CAGCGTGAGCCTCCAGCTGGTGG + Exonic
1077938842 11:6818356-6818378 CAGTGACAGCCTGAAGCATGGGG + Intergenic
1078174153 11:8956279-8956301 CAGTGATTGCCTTCATGTTGTGG - Exonic
1078277436 11:9863332-9863354 AAACGAGAGCCTTGAGCTTGGGG - Intronic
1084904523 11:72335432-72335454 CTGGGAGAGCCATGAGCTTGGGG - Intronic
1087125434 11:94621061-94621083 CAGTCACAGCCTTGAGCTTATGG - Exonic
1089322122 11:117633490-117633512 CACTGAAAGCCTTCAGCGCGTGG + Intronic
1090173441 11:124625689-124625711 CAGTTAGAGCCTGAAGCTGGAGG - Exonic
1092120557 12:6040764-6040786 CAGATACAGCCTGCAGCTTGTGG + Intronic
1092992928 12:13920606-13920628 CAGTGAGAGGCTCCAGACTGAGG + Intronic
1094076672 12:26483832-26483854 CTGTGAGACCCTTCAGTTTCTGG - Exonic
1096189388 12:49605415-49605437 CAGTGAAAGCCATCATCCTGAGG - Exonic
1099796466 12:87407256-87407278 CAGTAAGATCCTTCATCTAGTGG + Intergenic
1099922927 12:88981520-88981542 CAGTGAGGGCTTTAAGCTGGGGG - Intergenic
1101144288 12:101826919-101826941 CAGGGAGAGCCTTCAGAATGGGG - Intronic
1103395952 12:120607343-120607365 CAGTGGCAGCCTTCAGTCTGTGG - Intergenic
1106076430 13:26464958-26464980 CAGAGGGAACCATCAGCTTGAGG + Intergenic
1106620270 13:31365327-31365349 CAGAGAGAGCCTGAAGGTTGGGG + Intergenic
1107030009 13:35840965-35840987 CAGTGAGATCCTTCATCCTCTGG + Intronic
1107176919 13:37409934-37409956 CAATGAGTGCCTAGAGCTTGTGG - Intergenic
1107401575 13:40074464-40074486 CAGGGTTAGCCTACAGCTTGTGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109904181 13:68816738-68816760 CAGTGGGGGCCCTGAGCTTGTGG + Intergenic
1110569527 13:76989697-76989719 CTATGAGCACCTTCAGCTTGGGG + Intergenic
1111160171 13:84384291-84384313 GACTGAGAGCCATCTGCTTGGGG + Intergenic
1113633150 13:111901622-111901644 CTGTGGGAGCCTTGAACTTGTGG - Intergenic
1114342655 14:21760951-21760973 CAGTCAGACCCTTCAGCTTCAGG - Intergenic
1118549375 14:66932628-66932650 TAGGGAGAGACTTCTGCTTGAGG - Intronic
1118599544 14:67462272-67462294 CAGTGAGAACTTTCTGCATGGGG - Intronic
1119110526 14:71969528-71969550 CAGGCAGAGCCTCCAGCTTTTGG - Intronic
1125837452 15:42765025-42765047 CAGTCAGATCCTTCAGCTGCAGG - Intronic
1127932704 15:63607490-63607512 CAGGGAGAGACTCCAGCTTTGGG - Intergenic
1132730450 16:1358422-1358444 CACTGAGAGCCTCCAGCCTGGGG - Intronic
1132862870 16:2080086-2080108 CGGGGGGAGCATTCAGCTTGAGG + Intronic
1133874020 16:9716202-9716224 CAGGGAGAGCCTTGAGCTCATGG + Intergenic
1134210683 16:12273865-12273887 CCGTGAGAGCATTCAGCCAGGGG - Intronic
1137029704 16:35510358-35510380 CTGTCAGAGCCATCAGTTTGTGG + Intergenic
1139229315 16:65267767-65267789 CAGTGAAACACTTCAGCTTTGGG - Intergenic
1141535461 16:84676707-84676729 CTGTGAAAGCCATCAGCTAGAGG - Intergenic
1142879676 17:2874621-2874643 CAGTCAGAGGCCTCAGCCTGGGG + Intronic
1143157755 17:4849306-4849328 CAGAGAAAGCATTCAGCCTGAGG + Intronic
1143166141 17:4898106-4898128 CAGAGAGAGCCTCCAGGGTGGGG + Exonic
1144553313 17:16260278-16260300 CAGTGACAGCCTGAAGCCTGTGG + Intronic
1146712445 17:35054351-35054373 CAGAAAGAGGCCTCAGCTTGTGG - Intronic
1146794626 17:35772666-35772688 CAGCCAGAGTCTTCAGGTTGGGG + Intronic
1147135167 17:38429898-38429920 CAGTGAGAGCTGTCACTTTGGGG - Intronic
1147516549 17:41123454-41123476 CAATGAGAGCCTTCATCTGTAGG + Exonic
1147774989 17:42894435-42894457 CAGTGAGAAAGTTCAGCTTTAGG - Intergenic
1148903128 17:50893663-50893685 AATTGAGAGCGTTCATCTTGCGG - Intergenic
1149542716 17:57479858-57479880 CATTGGGAGACTGCAGCTTGTGG + Intronic
1153349272 18:4060128-4060150 CAGAGAGACCCTTCATCTTAAGG - Intronic
1156044806 18:32865996-32866018 GAGTGAGAGCCTTCAGATTTGGG + Intergenic
1158709728 18:59826822-59826844 CAATGGGAGCCCCCAGCTTGAGG + Intergenic
1158850861 18:61494858-61494880 CAGTGAGTGCTTACAGTTTGTGG - Intronic
1160272157 18:77397120-77397142 CAGTGAGAGCAGCCAGCTGGTGG + Intergenic
1161794744 19:6380231-6380253 CAGTGAGAGCCTTAAGTTCTGGG + Exonic
1164357912 19:27463754-27463776 CAGTGAGGGCTCTCAGCTTCAGG - Intergenic
1164413301 19:28023149-28023171 CCGTGAGGGCCAACAGCTTGTGG + Intergenic
1166000695 19:39875827-39875849 CAGCGAGAGCCCTGAGGTTGTGG + Exonic
1166003493 19:39892082-39892104 CAGCGAGAGCCCTGAGGTTGTGG + Exonic
927080994 2:19630475-19630497 CAGAGGGAGCCTCCTGCTTGGGG + Intergenic
928669565 2:33587466-33587488 CAGTGAGTGTCTTTATCTTGTGG - Intronic
929824326 2:45298569-45298591 CAGTGAGGCCCTTCAGTCTGGGG + Intergenic
930041526 2:47128843-47128865 CAGAGAGAGACTCCTGCTTGAGG - Intronic
931277411 2:60756130-60756152 TACTGAGAGCCCTGAGCTTGTGG + Intergenic
931440867 2:62289415-62289437 CAGTGAGAGCCTAGAGCTCTGGG + Intergenic
934121489 2:88844569-88844591 CAGATAGTGCCTTCACCTTGTGG + Intergenic
935054650 2:99554756-99554778 CAGTGAGTGCCATCTGCGTGAGG + Intronic
938792363 2:134688179-134688201 CAGTGAGAAGCTCCTGCTTGGGG - Intronic
939193302 2:138942198-138942220 CAGTCAGACCCCTCAGCTTCAGG + Intergenic
942411831 2:175717493-175717515 CAGTCAGAACCTTCAGCTGCAGG - Intergenic
945338484 2:208620429-208620451 CAATGAGCCCCTTCAGCCTGGGG - Intronic
946147575 2:217742595-217742617 CACTGAGATCCCTCAACTTGGGG + Intronic
948701046 2:239760549-239760571 CAGCGAGAGCCACCTGCTTGTGG - Intergenic
1169277423 20:4243285-4243307 CAGTGAGAGCCTGCTGCCTGCGG - Intronic
1169986720 20:11453194-11453216 CAGCAAGAGCCATCAGCCTGAGG - Intergenic
1171139852 20:22731152-22731174 CAGTGGGAGACTTGTGCTTGTGG + Intergenic
1172966679 20:38840440-38840462 CAGTGAGAGCAGTGAGCATGGGG - Intronic
1173400821 20:42724397-42724419 CAGTGAGAGGCTACAGCAGGAGG + Intronic
1173440903 20:43075227-43075249 CAGTGTGTTCTTTCAGCTTGGGG - Intronic
1174064508 20:47854808-47854830 CAGTGAGTGCCTCCAGCCGGGGG + Intergenic
1174887382 20:54350605-54350627 CAGTGAGAGCCTCCTGCTTCAGG + Intergenic
1177325892 21:19588018-19588040 CATTGTGAGACTTCACCTTGTGG + Intergenic
1177905690 21:26968506-26968528 CAGAGAAAGCGATCAGCTTGGGG - Intergenic
1178016861 21:28356850-28356872 CAGTGAAAGAGTTCAGCTGGAGG - Intergenic
1178326750 21:31652636-31652658 CAGTGGTTGCCTGCAGCTTGGGG + Intergenic
1178369160 21:32012622-32012644 TAGTGAGAGTCTTCTGCTGGTGG - Intronic
1179125668 21:38588531-38588553 CAGAAAGAACCTTGAGCTTGGGG + Intronic
1181939811 22:26466422-26466444 TAGTGGGAGCCAGCAGCTTGGGG - Intronic
1183268953 22:36848940-36848962 CAGTGAGAGCCAGCAGCCCGGGG + Intergenic
1184583871 22:45434734-45434756 CAGTGAGGTCCTTCATTTTGTGG - Intergenic
949254077 3:2024148-2024170 CACTGGTAGCCTTCAGCTTGTGG + Intergenic
950063762 3:10094242-10094264 CAGTGAGATACCTCAGCTAGAGG + Intronic
953024417 3:39136672-39136694 CAGGGAGAGCCTGCAGCCTCTGG + Intronic
953464234 3:43105511-43105533 CAGTTCGAGCCCTCAGCTCGTGG - Intronic
953914592 3:46910129-46910151 CAGTGAGGGGCTTGGGCTTGAGG + Intergenic
954326073 3:49864787-49864809 CTGTGAGTGCCTTCAGGTCGGGG - Intronic
954993659 3:54862600-54862622 CAGAGAGAGCCTTCAACTTCAGG - Intronic
955346564 3:58165951-58165973 TGGTGAGAGACTTCTGCTTGTGG + Intronic
956298764 3:67745416-67745438 AAGACAGACCCTTCAGCTTGTGG - Intergenic
957699169 3:83687142-83687164 CAGTAAGACTCTTCTGCTTGGGG - Intergenic
957775886 3:84756989-84757011 CAGGGACAGCCTTAAGCCTGGGG - Intergenic
960261304 3:115571603-115571625 CAGTGCCACCCTGCAGCTTGAGG - Intergenic
961762870 3:129184221-129184243 CAGTGACTGCCATTAGCTTGGGG + Intergenic
962539820 3:136369201-136369223 CAGAGAGGGCCTTCAGCCTTTGG - Exonic
962754949 3:138459797-138459819 CTGTGAGAGCAGGCAGCTTGGGG + Intronic
964715347 3:159715167-159715189 CAGTCAGAACCTTCAGCTGCAGG - Intronic
967030399 3:185600994-185601016 CAGTGAGAGACTTGAACTTAGGG + Intronic
968698293 4:2043051-2043073 CAGTGAGAGCCTTCTGGGGGAGG - Intronic
969216934 4:5730570-5730592 CAGTGAGGGCCTCCAGGGTGGGG - Intronic
970062619 4:12051732-12051754 CAGTGAGAGCATGCAGCGTTTGG - Intergenic
972414721 4:38827208-38827230 TCATGAGAGCCTTCAGCTTGTGG + Exonic
973327443 4:48877853-48877875 CAGTAAGAGACTCCTGCTTGAGG - Intergenic
973775129 4:54234765-54234787 CAGTTTGAGCATTCGGCTTGAGG - Intronic
973965054 4:56153260-56153282 CAGAGTGAGACTTCATCTTGGGG + Intergenic
974089186 4:57293029-57293051 CAATAAGAGACTTCATCTTGAGG + Intergenic
975463470 4:74682844-74682866 CAGTGAGAGAGTCCTGCTTGAGG - Intergenic
977090443 4:92667967-92667989 AATTGAGAGCTTTCAGCATGTGG + Intronic
978494104 4:109340478-109340500 CAGTCAGATCCTTCAGCTGTAGG - Intergenic
978521542 4:109620913-109620935 CAGAGAGAGACTCCATCTTGGGG - Intronic
979017384 4:115451939-115451961 CAGTCAGAGCCCTCAGCTGGAGG + Intergenic
979510616 4:121549925-121549947 CAGTCAGATCCTTCAGCTGCTGG + Intergenic
980801082 4:137751146-137751168 CAGTGAGAGCTATCAGATGGCGG - Intergenic
981410118 4:144419973-144419995 CAGTTTGGGACTTCAGCTTGTGG - Intergenic
981880524 4:149605825-149605847 CAGAGAGAGATTTCTGCTTGGGG + Intergenic
983486956 4:168343612-168343634 CAGTCAGGACCTTCAGCTTCAGG + Intergenic
984370191 4:178854224-178854246 TATTGAGAGCCTACAGTTTGTGG + Intergenic
989357992 5:40566633-40566655 CAGTCAGACCCCTCAGCTTCAGG + Intergenic
989516888 5:42354059-42354081 CAGTCAGGGCCTTCAGCTTCAGG - Intergenic
990280558 5:54246389-54246411 CTGTGAGAGTCTGAAGCTTGGGG - Intronic
990616465 5:57513332-57513354 AAGAGAGGCCCTTCAGCTTGTGG - Intergenic
994049180 5:95343432-95343454 CAGCCAGAGCTGTCAGCTTGGGG + Intergenic
996314186 5:122142814-122142836 CAGAAACAGCCTTCAGTTTGTGG + Intronic
999837053 5:155385569-155385591 CAGGGAGAGGCTACAGATTGGGG - Intergenic
1001564190 5:172688933-172688955 CACTGAGACCCCACAGCTTGTGG - Exonic
1002004084 5:176217472-176217494 CAGAGAGCCCCTTCAGCTTAAGG - Intergenic
1002222290 5:177693168-177693190 CAGAGAGCCCCTTCAGCTTAAGG + Intergenic
1004657263 6:17675302-17675324 GAGTGAGAACGTTCAGCTTCTGG + Exonic
1005207250 6:23419308-23419330 CATTGAGAGCTATCAGTTTGTGG + Intergenic
1008101034 6:47391793-47391815 CAGGGAGAGACTTCTGCTTGAGG - Intergenic
1013463978 6:110400767-110400789 TAGTGATAGCCTTGAGCTTATGG - Intronic
1014544538 6:122717932-122717954 CGGAGAGAGCCTCCAGTTTGAGG - Exonic
1016679079 6:146807479-146807501 CAGAGAGAGCTTCCAGCTTTAGG - Intronic
1017788317 6:157774313-157774335 AAGTGAGAGGCTACAGCTGGAGG + Intronic
1017827113 6:158089832-158089854 CAGTCCGAGCCTTGGGCTTGAGG - Exonic
1018000326 6:159572918-159572940 CACTGAGGCCCTTCTGCTTGAGG - Intergenic
1018170765 6:161141372-161141394 CAGTGAGAGCGATCAGATGGTGG + Intronic
1020677967 7:11202842-11202864 CAGTGAGAGGCTTTGGGTTGGGG - Intergenic
1021021138 7:15599956-15599978 CAGTGAGGGCCTGAAGCCTGGGG - Intergenic
1021785121 7:24143702-24143724 CAGTGAGAACCTTCAGTTCTTGG - Intergenic
1021865207 7:24949606-24949628 TAGTGGGAGCTGTCAGCTTGAGG - Intronic
1021922015 7:25495091-25495113 CAGTGAGAGGCTGCAGGCTGCGG - Intergenic
1023663840 7:42499002-42499024 CAGTGATTGCCTGCAGCTTGGGG - Intergenic
1023675669 7:42627431-42627453 GAGTAAGAGCTTTCAGCTAGAGG + Intergenic
1024666977 7:51557386-51557408 CAGTCAGAGCCCTCAGCTGCAGG + Intergenic
1025614343 7:63105347-63105369 CAGTGAGAAACCTCAGCTTCAGG - Intergenic
1027260679 7:76462262-76462284 CAGTGAGTCCCTTCACCTGGGGG - Intronic
1027312058 7:76960375-76960397 CAGTGAGTCCCTTCACCTGGGGG - Intergenic
1028033476 7:85949467-85949489 AAGAGAGACCCTTCAGTTTGGGG - Intergenic
1028035143 7:85972516-85972538 CAGAGACAGCCTTAAGCCTGGGG - Intergenic
1029120704 7:98266086-98266108 CAGAGAGAGCCTTGAGCGGGAGG - Intronic
1032287159 7:130547990-130548012 CAGGGAGAGCCTTATTCTTGAGG + Intronic
1032716906 7:134516802-134516824 CAGTGCGAGACTCCAACTTGGGG - Intergenic
1032717069 7:134518518-134518540 CAGTGTGAGACTCCAACTTGGGG - Intergenic
1032764431 7:134976883-134976905 CAGTCAGGACCTTCAGCTTCAGG - Intergenic
1033468242 7:141617305-141617327 CTGAGAGAGTCTTCAGTTTGGGG + Intronic
1036069961 8:5430555-5430577 CCATGAGAGCTTTCAGCTTTTGG - Intergenic
1036961595 8:13250052-13250074 CAGTGAGACCCTTCAGGGCGTGG + Intronic
1037320159 8:17633918-17633940 CAGTGTGAGCCCACAACTTGGGG - Intronic
1038707346 8:29907150-29907172 CACTGAGTGCTTTCAGGTTGGGG - Intergenic
1039210148 8:35204561-35204583 CAGGGAGAGCCTGAAGCCTGGGG - Intergenic
1039839034 8:41280472-41280494 GAGTCAGGGCATTCAGCTTGAGG - Intronic
1042958459 8:74277240-74277262 CAGTGAGGGCCTCCAGATGGCGG - Intronic
1044053763 8:87542690-87542712 CAGGGAGGGCCTGCAGCCTGGGG - Intronic
1046674674 8:117094683-117094705 CAGGGAGAGCCTGAAGCCTGGGG - Intronic
1048112131 8:131479938-131479960 CAGTGAGCTCTCTCAGCTTGAGG + Intergenic
1049610981 8:143555230-143555252 GTGTGAGAGCCTTCAGGGTGAGG + Intronic
1049776219 8:144406586-144406608 AAGTCAGAGTCTTCAGCCTGGGG - Intronic
1050045973 9:1545511-1545533 CAGTGCAAGCCTTCAGTCTGTGG + Intergenic
1051355168 9:16234141-16234163 CAGGGACAGCCTGAAGCTTGAGG + Intronic
1051379884 9:16445662-16445684 GAGTGAGAGTCTTCAGGGTGTGG + Intronic
1051864106 9:21659627-21659649 CAGTTCCAGCCTTCAGCTTCTGG - Intergenic
1051998459 9:23247975-23247997 CAGTGAGAGCTTTAAGCCAGTGG - Intergenic
1053117816 9:35520860-35520882 CATTGAGAGACTTTAGCCTGTGG + Intronic
1055248131 9:74271772-74271794 CAGTCATAGCCTTCAACATGAGG + Intergenic
1055578001 9:77679123-77679145 CAGAGAGAGCCATCATCTGGTGG - Intergenic
1055732143 9:79289146-79289168 CAGTGAGAGGCTTCTGCATAGGG + Intergenic
1055846451 9:80569295-80569317 CTGAGAGTGACTTCAGCTTGGGG - Intergenic
1057253012 9:93519151-93519173 CAGTCAGACCATTCAGCTGGTGG + Intronic
1057949278 9:99356881-99356903 CTGTGGGAGCCTTCATGTTGTGG + Intergenic
1059612267 9:115911335-115911357 CTTTGAAAGCCTTAAGCTTGTGG - Intergenic
1190876191 X:54461947-54461969 CAGTGAGAGCCTTCAGCTTGAGG - Intronic
1193786171 X:85761562-85761584 CAGTGGGAGACTTAGGCTTGAGG + Intergenic
1196224578 X:113150799-113150821 CTGTGAGAGTCTTCAGATAGTGG + Intergenic
1197203191 X:123766835-123766857 CAGTGAGAGCCTTCATGAAGTGG - Intergenic
1197432554 X:126384057-126384079 CAGTCAGAGCCCTCAGCTGCAGG - Intergenic
1199837832 X:151611016-151611038 CACTGATAGCCTAGAGCTTGGGG - Intronic
1201710033 Y:16980824-16980846 CAGTCAGAGACTCCATCTTGAGG + Intergenic
1201974967 Y:19839308-19839330 CAGTCAGAACCCTCAGCTTCAGG + Intergenic
1202343188 Y:23890368-23890390 CAGTCAGGTCCTTCAGCTTCAGG - Intergenic
1202527580 Y:25779717-25779739 CAGTCAGGTCCTTCAGCTTCAGG + Intergenic