ID: 1190878897

View in Genome Browser
Species Human (GRCh38)
Location X:54478829-54478851
Sequence GTGTATATACAGTTTTACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190878897 Original CRISPR GTGTATATACAGTTTTACGT TGG (reversed) Intronic
901112443 1:6809368-6809390 GTGTATATACAGCGTGACATTGG + Intronic
905086510 1:35383841-35383863 GTTCAAATACAGTTTTACCTTGG + Intronic
906123216 1:43409007-43409029 GTCTATATACAATTTTAGGATGG + Intronic
907720759 1:56969887-56969909 GTGTATATACATTTTTCTGGGGG + Intergenic
909971735 1:81998924-81998946 GTGTATATATAGTTATATATAGG - Intergenic
909971738 1:81998968-81998990 GTGTATATATAGTTATATATAGG - Intergenic
911006103 1:93226212-93226234 GTGAATATACAGTCCTACTTAGG - Intronic
913692440 1:121292000-121292022 GTCTAACTACAGTTTTATGTGGG + Intronic
914145117 1:144988102-144988124 GTCTAACTACAGTTTTATGTGGG - Intronic
915182566 1:154075307-154075329 GTGTATATATATGTATACGTGGG - Intronic
917700451 1:177575355-177575377 GTGTTTGTACAGTGTTACATAGG - Intergenic
918962130 1:191293986-191294008 CTGTATATGCAGTGTTACATAGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
920479761 1:206310357-206310379 GTCTAACTACAGTTTTATGTGGG + Intronic
923652085 1:235883526-235883548 GTGTTTATTCATTCTTACGTGGG - Intronic
1063814529 10:9757488-9757510 GTTTATTTACAGTTTTCCATAGG - Intergenic
1065030902 10:21584712-21584734 GTGTATATATATTTATATGTAGG + Intronic
1067225030 10:44370202-44370224 GTGCATATACATTTTTTCATTGG + Intronic
1067916538 10:50406008-50406030 GTGTATATATATATTTAGGTGGG - Intronic
1070091844 10:73294508-73294530 GTGTCTATGCAGTTTTCCTTAGG - Intronic
1071851027 10:89570645-89570667 GTGTATATACTTTTTAACGCTGG + Intergenic
1072893339 10:99344523-99344545 TATTATATACAGTTTTACATGGG - Intronic
1073585582 10:104706773-104706795 GTGCATATACATGTTTATGTAGG - Intronic
1076089651 10:127671299-127671321 CTGTATTTACAGTTTTACTCGGG - Intergenic
1080434976 11:32231448-32231470 CTGTATATACATTTTTAAATGGG + Intergenic
1080592842 11:33738351-33738373 GTGTATCTACTCTTTTACCTTGG + Intergenic
1081272590 11:41103950-41103972 GTTTATATATAGTTTGAAGTAGG - Intronic
1082860087 11:57847247-57847269 GTTTATATACAGTGTGAGGTAGG - Intergenic
1087246513 11:95844550-95844572 GTGTTTATACAGTTGTCCCTTGG - Intronic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG + Intronic
1092796933 12:12121076-12121098 TTATATTTACATTTTTACGTTGG + Exonic
1093343544 12:18010452-18010474 CTGTATATAGAGTTCTAGGTTGG + Intergenic
1094383827 12:29872478-29872500 GTGTGTGTACAATTTTAAGTAGG + Intergenic
1095314047 12:40737303-40737325 GTGTATATACACATATACATGGG + Intronic
1095495082 12:42775740-42775762 GTCTATGTACAGTTTTTCCTTGG + Intergenic
1095931713 12:47634650-47634672 GTGTATATACACATATATGTGGG + Intergenic
1100440361 12:94611547-94611569 GTATATATACAGTTGTCCCTTGG + Intronic
1102762662 12:115402145-115402167 GCATTTATACAGTTTTACTTAGG + Intergenic
1102796417 12:115692645-115692667 ATGTATATACAGCTATACATTGG - Intergenic
1105848036 13:24309730-24309752 ATGTCTATACAGTTTTGGGTAGG + Intronic
1107762997 13:43701886-43701908 GTATATATATAGTTTTACATAGG + Intronic
1108507090 13:51121973-51121995 TTGTATATACTGTTTTACATTGG - Intergenic
1109278533 13:60329313-60329335 GTGTATCAACAGTATTATGTTGG - Intergenic
1109752334 13:66711001-66711023 GTGAATATATCGTTTTACATTGG - Intronic
1110586166 13:77196054-77196076 TTGAATTTACAGTTTTAAGTAGG + Intronic
1118036550 14:61874477-61874499 GTGTATGTACAGTTGTTCCTCGG - Intergenic
1118302818 14:64630445-64630467 GTATATATACAGTTGTTCTTCGG - Intergenic
1126282969 15:46978318-46978340 GTATATACACACTTTTAAGTGGG + Intergenic
1126763523 15:51991235-51991257 GTGTATATATAGGCTTACATAGG + Intronic
1130764690 15:86858039-86858061 GTGGATATAAGGTGTTACGTGGG - Intronic
1135288875 16:21217558-21217580 CTGTATATACAGTTTTTCATAGG - Intergenic
1135502174 16:23005908-23005930 GTGAAAAGACAGTTTTACTTGGG + Intergenic
1139016758 16:62698697-62698719 GTGTATATACATCATCACGTGGG + Intergenic
1139621983 16:68152716-68152738 GTTTTTATACATTTTTACATGGG + Intronic
1140238451 16:73180074-73180096 CTGTTTATACAGTTTCCCGTAGG - Intergenic
1147061760 17:37885519-37885541 GTGTATATATATTTATATGTAGG - Intergenic
1149933082 17:60775543-60775565 ATGTATATATAGGTTTACCTTGG + Intronic
1150101156 17:62424513-62424535 TTTTATATATAGTTTTACTTTGG + Intronic
1151015871 17:70552109-70552131 GTGTGTATACAGCTTTACATTGG - Intergenic
1153033655 18:738344-738366 GTATATATACAGTTTAAAATGGG - Intronic
1157800709 18:50618492-50618514 TTATATATACATTTTTACGGTGG - Intronic
1160349786 18:78167236-78167258 TTGTATATACAGTATTACATAGG + Intergenic
1165082721 19:33318597-33318619 ATATATATATAGTTTTACTTTGG - Intergenic
925968294 2:9086810-9086832 GTGTATAAACACTTCCACGTTGG + Intergenic
930431903 2:51288458-51288480 GTGTATCTACATTTTGTCGTAGG + Intergenic
932030869 2:68183193-68183215 GTGTATAGAGAATTTTAAGTTGG + Intronic
939280869 2:140063207-140063229 GTTTAGATACATTTTTACTTAGG - Intergenic
940284441 2:152019750-152019772 GTGTATATACATTTATACAAAGG + Intronic
940386606 2:153081156-153081178 TGGTATATACATTTTTACTTTGG + Intergenic
941952937 2:171175563-171175585 GTGTATGTACAGTTGTCCCTTGG - Intronic
944676636 2:202038339-202038361 GTATTTATACATTTTTACTTTGG + Exonic
1169824595 20:9753491-9753513 GTGTATATAGAGTTTCACAGAGG + Intronic
1177919076 21:27127617-27127639 TTGTATATACAATTTTATTTTGG + Intergenic
952564494 3:34638591-34638613 GTGTATATAATGTTTTGCTTAGG + Intergenic
959490865 3:106986967-106986989 TTGTATATACAGTTTTTTGGGGG - Intergenic
961662893 3:128479783-128479805 GTTTATATACAGCTGTACCTTGG + Exonic
961993637 3:131218270-131218292 GTGTATATAGAGTTTGGTGTGGG + Intronic
966242766 3:177773198-177773220 TTGTATAAACAGTTTTGTGTAGG + Intergenic
966323542 3:178728766-178728788 GTGTATATACTATTTTTTGTAGG - Intronic
966486221 3:180474059-180474081 GTTTGTATACAGTTTTCTGTTGG + Intergenic
968024500 3:195428268-195428290 GTATATATACAGTCATACATAGG + Intronic
968513742 4:1006912-1006934 GTGTAGATTCAGTTTTCCATTGG + Intergenic
974773396 4:66446116-66446138 AATTATATACAGTTTTAGGTAGG + Intergenic
975078836 4:70249615-70249637 GGGTACTTACAGTTTTACCTTGG + Intronic
975601970 4:76110473-76110495 CTGTATATCCAGTTGTATGTTGG + Intronic
975987018 4:80209900-80209922 ATATATATATAGTTTTATGTGGG - Intergenic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
978054539 4:104247720-104247742 CTGTATATACAGTTCTTGGTTGG + Intergenic
978153307 4:105462902-105462924 TTGGATTTACAGTTTTACATGGG - Intronic
980705476 4:136487558-136487580 TATTATATACAGTTTTTCGTTGG - Intergenic
985187293 4:187331499-187331521 GTCTATCTACAGTTTTGCCTGGG + Intergenic
988807964 5:34758108-34758130 GTTTATATCCATTCTTACGTTGG + Intronic
990289618 5:54334831-54334853 ATGTATCTACAGTGTTACTTGGG - Intergenic
990734551 5:58845682-58845704 GTGTATATATAGTTTTATAGAGG + Intronic
991153384 5:63399329-63399351 ATCTATTTACAGTTTTACTTTGG + Intergenic
992165920 5:74051526-74051548 GTTTATATACATTTTTATTTTGG + Intergenic
994406147 5:99347255-99347277 ATGTATATAAAGTTCAACGTAGG + Intergenic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1009688589 6:66996218-66996240 GTGTATATGCAATTTTTCATAGG - Intergenic
1010939573 6:81900433-81900455 GTGTTTATACAGTTTTAGGAGGG + Intergenic
1017425843 6:154320702-154320724 ATGTATATACAGTTTTGTTTGGG - Intronic
1021138453 7:16993963-16993985 GTGAATTTGCAGTTTTATGTTGG - Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1022564762 7:31386879-31386901 GTGTATATACATATACACGTGGG + Intergenic
1024163459 7:46704691-46704713 ATGTATATACACTTTTATTTAGG - Intronic
1026782029 7:73274721-73274743 ATATATATACATTTTTACATTGG - Intergenic
1027065134 7:75117737-75117759 ATATATATACATTTTTACATTGG + Intronic
1027361354 7:77413832-77413854 GTGGATACACGGTTTTACTTCGG + Intronic
1027591294 7:80122271-80122293 TTTTATATACAGTTGTACCTTGG + Intergenic
1030940342 7:115639133-115639155 TTGTATGTAAAGTTTTACTTGGG + Intergenic
1031343390 7:120633885-120633907 GAATATATACAATTTTAAGTTGG + Intronic
1032950819 7:136909957-136909979 GTGTATGTACAGTTTTATCATGG - Intronic
1038043836 8:23749571-23749593 GTGAATTTGCAGTTTTACCTGGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039645060 8:39272717-39272739 GTGTTTATACAGTTTATAGTAGG - Intronic
1043753173 8:83967323-83967345 CTATATATACAATTTTACCTAGG - Intergenic
1043792118 8:84483824-84483846 CAGAATATACAGTTTTACTTTGG + Intronic
1044691551 8:94884993-94885015 GTGTATATATAGTCTTAAATAGG - Intronic
1044836833 8:96303767-96303789 GAGTGTGTGCAGTTTTACGTGGG + Intronic
1045092575 8:98761717-98761739 TTGTATATTCAGTTTTGGGTGGG - Intronic
1048005598 8:130417039-130417061 GTGTGTATGCAGTTGTACATGGG - Intronic
1048005606 8:130417181-130417203 GTGTGTGTGCAGTTGTACGTGGG - Intronic
1048630945 8:136241670-136241692 ATGTATATACAATTTTACTGTGG - Intergenic
1051853148 9:21532398-21532420 CTGTAAATACAGTTATACTTGGG - Intergenic
1052001117 9:23282176-23282198 GTGAAAATACTGTTTTACATAGG + Intergenic
1058285686 9:103175270-103175292 GTATATATACAGGTATATGTTGG + Intergenic
1058748324 9:108014061-108014083 TTGTATAAACAGTCTTACATAGG + Intergenic
1185536746 X:868613-868635 ATGTATATACAGTTTTTAGGAGG - Intergenic
1187049030 X:15677830-15677852 GTGTAAATACAGTTTTTAGTGGG - Intergenic
1187808188 X:23144343-23144365 GTGCATTTTCAGTTGTACGTAGG + Intergenic
1188160304 X:26792188-26792210 GTATATTTACATTTTTACATTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1198012952 X:132577955-132577977 GTGTGTATACATATTTATGTAGG + Intergenic
1199379607 X:147154412-147154434 TTGTATATACAGTTTAAATTAGG - Intergenic
1199402581 X:147416250-147416272 TTGTTTATACAGTTTTTCATTGG + Intergenic