ID: 1190894408

View in Genome Browser
Species Human (GRCh38)
Location X:54602608-54602630
Sequence TTTTATGTAATATAACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190894408_1190894409 -8 Left 1190894408 X:54602608-54602630 CCATTAGGTTATATTACATAAAA No data
Right 1190894409 X:54602623-54602645 ACATAAAACTCTTGTCTTGCTGG No data
1190894408_1190894411 18 Left 1190894408 X:54602608-54602630 CCATTAGGTTATATTACATAAAA No data
Right 1190894411 X:54602649-54602671 GAGACTCTAGAGACTTTTCTTGG No data
1190894408_1190894410 -4 Left 1190894408 X:54602608-54602630 CCATTAGGTTATATTACATAAAA No data
Right 1190894410 X:54602627-54602649 AAAACTCTTGTCTTGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190894408 Original CRISPR TTTTATGTAATATAACCTAA TGG (reversed) Intergenic
No off target data available for this crispr