ID: 1190894409

View in Genome Browser
Species Human (GRCh38)
Location X:54602623-54602645
Sequence ACATAAAACTCTTGTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190894407_1190894409 -5 Left 1190894407 X:54602605-54602627 CCACCATTAGGTTATATTACATA No data
Right 1190894409 X:54602623-54602645 ACATAAAACTCTTGTCTTGCTGG No data
1190894408_1190894409 -8 Left 1190894408 X:54602608-54602630 CCATTAGGTTATATTACATAAAA No data
Right 1190894409 X:54602623-54602645 ACATAAAACTCTTGTCTTGCTGG No data
1190894406_1190894409 -4 Left 1190894406 X:54602604-54602626 CCCACCATTAGGTTATATTACAT No data
Right 1190894409 X:54602623-54602645 ACATAAAACTCTTGTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190894409 Original CRISPR ACATAAAACTCTTGTCTTGC TGG Intergenic
No off target data available for this crispr