ID: 1190895864

View in Genome Browser
Species Human (GRCh38)
Location X:54617391-54617413
Sequence CAATTATAGTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190895864_1190895871 24 Left 1190895864 X:54617391-54617413 CCCTCTGCCCTCTACTATAATTG No data
Right 1190895871 X:54617438-54617460 CTCTTACTTGTTAAATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190895864 Original CRISPR CAATTATAGTAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr