ID: 1190897825

View in Genome Browser
Species Human (GRCh38)
Location X:54638920-54638942
Sequence AGTTTGCCCCAGCATTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190897822_1190897825 15 Left 1190897822 X:54638882-54638904 CCTCTAGATCTAAGGTTCTTAAA No data
Right 1190897825 X:54638920-54638942 AGTTTGCCCCAGCATTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190897825 Original CRISPR AGTTTGCCCCAGCATTACCC TGG Intergenic
No off target data available for this crispr