ID: 1190905469

View in Genome Browser
Species Human (GRCh38)
Location X:54722913-54722935
Sequence GGCCCACCCACAACTAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190905469_1190905475 21 Left 1190905469 X:54722913-54722935 CCAGATCTAGTTGTGGGTGGGCC No data
Right 1190905475 X:54722957-54722979 ACTGAAATGTCACCTCCTCAGGG No data
1190905469_1190905471 -7 Left 1190905469 X:54722913-54722935 CCAGATCTAGTTGTGGGTGGGCC No data
Right 1190905471 X:54722929-54722951 GTGGGCCCATTGTTTCATTCGGG No data
1190905469_1190905470 -8 Left 1190905469 X:54722913-54722935 CCAGATCTAGTTGTGGGTGGGCC No data
Right 1190905470 X:54722928-54722950 GGTGGGCCCATTGTTTCATTCGG No data
1190905469_1190905474 20 Left 1190905469 X:54722913-54722935 CCAGATCTAGTTGTGGGTGGGCC No data
Right 1190905474 X:54722956-54722978 AACTGAAATGTCACCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190905469 Original CRISPR GGCCCACCCACAACTAGATC TGG (reversed) Intergenic
No off target data available for this crispr