ID: 1190911857

View in Genome Browser
Species Human (GRCh38)
Location X:54778663-54778685
Sequence AAGAGTTAGTGGCCCTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 1, 2: 14, 3: 325, 4: 547}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190911855_1190911857 -5 Left 1190911855 X:54778645-54778667 CCACAGATAGGCAAATCTAAGAG 0: 1
1: 2
2: 59
3: 327
4: 716
Right 1190911857 X:54778663-54778685 AAGAGTTAGTGGCCCTAATGAGG 0: 1
1: 1
2: 14
3: 325
4: 547
1190911853_1190911857 16 Left 1190911853 X:54778624-54778646 CCTACATGATCTAGAAAATAGCC 0: 7
1: 216
2: 418
3: 478
4: 451
Right 1190911857 X:54778663-54778685 AAGAGTTAGTGGCCCTAATGAGG 0: 1
1: 1
2: 14
3: 325
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190911857 Original CRISPR AAGAGTTAGTGGCCCTAATG AGG Intronic
906153870 1:43602891-43602913 CAGAGTTAGTGGCCTATATGGGG + Intronic
906756380 1:48320141-48320163 AAGAGATATTGGCCTTAAAGAGG + Intronic
906903370 1:49862418-49862440 AAGAGATAATGGCCTTAAAGAGG + Intronic
906906172 1:49894798-49894820 AAGATTTACTGGCCTTAAAGGGG + Intronic
906909188 1:49927752-49927774 AAGAGTTATTGACCTTAAAGAGG + Intronic
907004076 1:50892793-50892815 AAGAGTTATTGGTCTTAAAGAGG - Intronic
908175394 1:61550984-61551006 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
908302121 1:62772641-62772663 AAGACTTATTGGCCCTAAAGAGG - Intergenic
908598820 1:65717407-65717429 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
909084254 1:71153060-71153082 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
909438845 1:75674751-75674773 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
909615963 1:77608041-77608063 AAGAGTTATTAGCCTTAAAGAGG + Intronic
909870488 1:80732463-80732485 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
910102360 1:83592668-83592690 AAGAATTATTGGCCTTAAAGAGG - Intergenic
910330808 1:86070361-86070383 GAGAGTTATTGGCCTTAAAGAGG + Intronic
910349121 1:86276136-86276158 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
910379098 1:86607412-86607434 AAGAATTATTGACCCTAAAGAGG - Intergenic
910547525 1:88434544-88434566 AAGAGTTATTGGCCCTAAAGTGG + Intergenic
910560389 1:88583527-88583549 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
910627300 1:89321632-89321654 AAATGTTATTGGCCTTAATGAGG - Intergenic
910716240 1:90234701-90234723 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
910733291 1:90422285-90422307 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
910801191 1:91148323-91148345 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
910861946 1:91750399-91750421 AGGAGTTTTTGGCCCTATTGTGG - Intronic
911343770 1:96672625-96672647 AAGAGTTATTGACCTTAAAGAGG - Intergenic
911975668 1:104490897-104490919 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912059155 1:105642754-105642776 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912070930 1:105808295-105808317 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
912099832 1:106191589-106191611 AAGAGTTATTGGCCTTATTAAGG + Intergenic
912117137 1:106420354-106420376 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912136017 1:106660988-106661010 AAGAGTTATTTGCCTTAAAGAGG + Intergenic
912598719 1:110905163-110905185 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912601293 1:110935727-110935749 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912633083 1:111266094-111266116 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
912883125 1:113438677-113438699 AAGAGCTAGTTGCCTTAAAGAGG - Intronic
912899089 1:113629027-113629049 AAGAGTTATTGGCCCAAAAGAGG - Intronic
912906790 1:113715994-113716016 AAGAGTTACTGACCTTAAAGAGG + Intronic
913032380 1:114922242-114922264 AAGAGTCATTGGCCTTAAAGAGG - Intronic
913707083 1:121435884-121435906 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
915186305 1:154107965-154107987 AAGAGCTACTGGCCTTAAAGAGG + Intronic
915811058 1:158911035-158911057 AAGAGTTACTGGCCTTGAAGAGG + Intergenic
915857012 1:159398817-159398839 AAGAATTACTGGCCTTAAAGAGG + Intergenic
916369298 1:164072522-164072544 AAGAGTTACTGGCTTTAAAGAGG - Intergenic
916616229 1:166443796-166443818 AAGAGTTAGTGGCCTTAAAGAGG - Intergenic
917061540 1:171047281-171047303 AAGAGTCACTGGCCTTAAAGAGG - Intronic
917300489 1:173569562-173569584 AAGTGTTATTGGCCTTAAAGAGG - Intronic
917364187 1:174210624-174210646 AAAAGTTATTGGCCTTAAAGAGG + Intronic
917986443 1:180325207-180325229 AAGAGTTATTGGCCTTAAGGAGG - Intronic
918415916 1:184308756-184308778 AAGAATTATTGGCCTTAAAGAGG - Intergenic
918666063 1:187153111-187153133 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
918671462 1:187222763-187222785 AAGAGTTACTGGCTTTAAAGAGG - Intergenic
918871506 1:189980972-189980994 AAGAGTTATTGGCCATAAAAAGG - Intergenic
918986229 1:191630793-191630815 AAGAGTTATTGGTCTTAAAGCGG + Intergenic
919067940 1:192716085-192716107 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
919283881 1:195527587-195527609 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
919511693 1:198473188-198473210 AACAGTTATTGGCCATAAAGAGG + Intergenic
920549826 1:206848960-206848982 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
920924021 1:210325047-210325069 GAGAGTTACTGGCCTTAAAGAGG - Intergenic
920953478 1:210596437-210596459 AAGAGTTACTGGCCTTAAAAGGG - Intronic
921002506 1:211057744-211057766 AAAAGTTATTGGCCTTAAAGAGG + Intronic
921042820 1:211449922-211449944 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
921775189 1:219089677-219089699 AAGATTTACTGGCCTTAAAGAGG + Intergenic
923867576 1:237956452-237956474 AAGAGTTACTGGTCCTAAAGAGG + Intergenic
924515997 1:244766794-244766816 AAGACTTATTGGCCTTAAAGAGG - Intergenic
1062765740 10:63410-63432 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1064156116 10:12904587-12904609 GAGATTGAGTGGCCTTAATGTGG + Intronic
1064446696 10:15400094-15400116 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1064521557 10:16208389-16208411 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1065426828 10:25615007-25615029 AAGACTTATTGGCCTTAAAGAGG - Intergenic
1065431288 10:25659924-25659946 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1065461043 10:25965213-25965235 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1066527130 10:36293782-36293804 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1069147978 10:64919021-64919043 AAGAGTTAGTGGTCTTAAAGAGG + Intergenic
1069391910 10:67944982-67945004 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1069397619 10:68007086-68007108 AAGGGTTACTGGCCTTAAAGAGG - Intronic
1070445116 10:76491788-76491810 AAGAGTAATTGGCCTTAAAGAGG - Intronic
1070464400 10:76705036-76705058 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1070755868 10:78992918-78992940 AAGAGTTAGTGGCCCAAATTAGG + Intergenic
1071046482 10:81385860-81385882 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1071209327 10:83319200-83319222 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1071896574 10:90074612-90074634 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1071963172 10:90825888-90825910 AAGAGTCACTGGCCTTAAAGAGG + Intronic
1072396799 10:95051387-95051409 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1072399772 10:95085729-95085751 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1072843181 10:98797516-98797538 AAGAGATATTGGCCTTAAAGAGG + Intronic
1072853569 10:98923505-98923527 AAGAGTTATTGGCTTTAAAGAGG - Intronic
1072862860 10:99024450-99024472 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1073766747 10:106691003-106691025 AAGCATTAGTGCCCCAAATGTGG + Intronic
1075195110 10:120349625-120349647 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1075830415 10:125406226-125406248 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1077740599 11:4841196-4841218 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1077970445 11:7183275-7183297 AAGAGTAATTGGCCCTAAAGAGG + Intergenic
1078036954 11:7815851-7815873 AAGAGTTATTGGCCTTAAACAGG + Intergenic
1078244474 11:9561698-9561720 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1078305477 11:10180683-10180705 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1078518908 11:12047819-12047841 AAGAGCTAGTGTGCCTAAAGTGG + Intergenic
1078691046 11:13580918-13580940 AAGAGTTATTGGCCCTAAAAAGG + Intergenic
1078842868 11:15095297-15095319 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1079038114 11:17038295-17038317 AAGAGTTATTGGCCTTAAAGCGG + Intergenic
1079183710 11:18216821-18216843 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1079473711 11:20806649-20806671 ATGAGTTATTGGCCTTAAAGGGG - Intronic
1079625833 11:22616883-22616905 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1079701553 11:23554877-23554899 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1080707047 11:34706091-34706113 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1081049339 11:38317411-38317433 AAGAGTAATTGGCCTTAACGAGG + Intergenic
1081245910 11:40765860-40765882 AAGAGTCATTGGCCTTAAGGAGG + Intronic
1082225468 11:49701716-49701738 AAGAGTTATTGGCCTTAAATAGG - Intergenic
1082823910 11:57563979-57564001 AAGAGTTACTGGCCTTAAATAGG + Intronic
1085007961 11:73112603-73112625 AAGAGTTATTGACCTTAAAGAGG - Intronic
1085147499 11:74214357-74214379 AAGAGTTAGTGGTCTTAAAGAGG + Intronic
1085194500 11:74660417-74660439 AAGAGTTATTGACCTTAAAGAGG - Intronic
1085372122 11:76018945-76018967 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1086068928 11:82777392-82777414 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1086261268 11:84944342-84944364 AAGAGTTATTGGTCTTAAAGAGG - Intronic
1086623613 11:88917860-88917882 AAGAGTTATTGGCCTTAAATAGG + Intronic
1086847699 11:91772656-91772678 AAGAGTTAACGGCCTTAAAGTGG - Intergenic
1087178468 11:95118770-95118792 AAGAATTACTGGCCTTAAAGAGG - Intronic
1087378406 11:97372621-97372643 GAGAGTTACTGGCCTTAAGGGGG + Intergenic
1087503078 11:98984519-98984541 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1087821240 11:102715141-102715163 AGTAGTTAGTGGTCCTGATGGGG + Intronic
1087877116 11:103371332-103371354 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1087887729 11:103499206-103499228 AAGAGTTACTAGCCTTAAAGAGG + Intergenic
1088182007 11:107122921-107122943 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1088330814 11:108649046-108649068 AAGAGTTATTGGCCTTAAAGTGG + Intergenic
1088361850 11:108999817-108999839 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1088411345 11:109538199-109538221 AAGAGTTATTGGCCCTAAAGGGG - Intergenic
1088985369 11:114901091-114901113 AAGAGTTATTGGCATTAAAGAGG + Intergenic
1089824532 11:121263333-121263355 AAGAGTTACTGGACCTAAAGTGG - Intergenic
1090316601 11:125796278-125796300 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1092320356 12:7466183-7466205 AAGAGTTATTGGCCTTAAAAAGG + Intronic
1092326574 12:7537855-7537877 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1092642555 12:10531662-10531684 AAGAGTTATTGGCCTTACAGAGG + Intergenic
1093321159 12:17717216-17717238 AAGAGTCACTGGCCTTAAAGAGG - Intergenic
1093403764 12:18779553-18779575 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1093403956 12:18781726-18781748 AAGAGTTACTGGCTTTAAAGAGG + Intergenic
1093581488 12:20789145-20789167 AAGAGTTATTGTCCTTAAAGAGG - Intergenic
1093694509 12:22144841-22144863 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1093988663 12:25566205-25566227 AAGAGTTATTGGCCTCAAAGAGG - Intronic
1094258747 12:28466240-28466262 AAGAGTTATTGGCCCTAAAGAGG + Intronic
1094328070 12:29261451-29261473 AAGAGTCATTGGCCTTAAAGAGG + Intronic
1094658008 12:32439783-32439805 AAAAGTTATTGGCCTTAAAGAGG - Intronic
1094757674 12:33490989-33491011 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1094815928 12:34184762-34184784 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1095807970 12:46342084-46342106 AATAGTTATTGGCCTTACTGAGG - Intergenic
1096700866 12:53381708-53381730 AGGAGTTGGTGGCAATAATGGGG + Exonic
1097146835 12:56947224-56947246 AAGAGTTATGGGCCTTAATGAGG - Intergenic
1097466421 12:59930125-59930147 AAGAGTTATTGGCCTTAACTAGG + Intergenic
1097508787 12:60509068-60509090 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1097563488 12:61238378-61238400 AAGTGTTATTGGCCTTAAAGAGG - Intergenic
1097770112 12:63573474-63573496 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1097791416 12:63819193-63819215 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1097899037 12:64855439-64855461 AACAGTTATTGGCCTTAAAGTGG - Intronic
1098060504 12:66555948-66555970 AAGAGTTATTAACCTTAATGAGG + Intronic
1098207737 12:68131222-68131244 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1098434078 12:70450570-70450592 AAGACTTAGTGGCTTTCATGTGG + Intergenic
1098959203 12:76720635-76720657 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1099054987 12:77828298-77828320 AAGAGTGAGGGGCCCATATGTGG - Intergenic
1099100784 12:78438276-78438298 AAGAGTTATGAGCCCTAAAGAGG - Intergenic
1099495523 12:83341367-83341389 AAGAGTTATTGGCCTTAAATAGG + Intergenic
1099609940 12:84855892-84855914 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
1099764005 12:86959489-86959511 AAGAGTTATTGGCCTTAAACAGG - Intergenic
1099808337 12:87548043-87548065 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1099911801 12:88842934-88842956 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1100360616 12:93876432-93876454 AAGAGTTATTGGCCTTAAATAGG - Intronic
1100875894 12:98961041-98961063 AAGTGTTATTGGCCCTAAAGAGG + Intronic
1100923765 12:99520672-99520694 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1100946545 12:99789891-99789913 AAAAGTTACTGGCCTTAAAGAGG + Intronic
1101162402 12:101992655-101992677 AAGAGTTATTGGCTCTAAAGAGG - Intronic
1101431819 12:104633241-104633263 ATGAGTTATTGTCCCAAATGAGG - Intronic
1101713221 12:107288030-107288052 AAGAGTTTGTGGTGCAAATGAGG + Intergenic
1102067724 12:109992013-109992035 CACAGTTTGTAGCCCTAATGTGG + Intronic
1102232137 12:111269967-111269989 ATGAATTAGAGGCCCTAAAGGGG - Intronic
1104298604 12:127541998-127542020 AAGAGTGAGGGTCCCAAATGGGG + Intergenic
1105747001 13:23386786-23386808 AAGAGTTAGAGGCCATTATAGGG + Intronic
1107083778 13:36404259-36404281 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1107370043 13:39736113-39736135 AAGAGTTGTTGGCCTTAAAGAGG - Intronic
1107552032 13:41486141-41486163 AAGAGGTATTGGCCTTAAAGAGG - Intergenic
1107808055 13:44173338-44173360 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1109554479 13:63954272-63954294 AAGAATTATTGGCCTTAATCAGG - Intergenic
1110345718 13:74445651-74445673 AATAGTCCATGGCCCTAATGAGG + Intergenic
1110376879 13:74804080-74804102 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
1110486748 13:76053890-76053912 AAGAGTTATTGGCTTTAATGAGG + Intergenic
1110806763 13:79764075-79764097 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1110916581 13:81029160-81029182 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1111130496 13:83969002-83969024 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1111365065 13:87233110-87233132 AAGAGTTATTGGCCTTAAAAGGG - Intergenic
1111639494 13:90948822-90948844 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1112137145 13:96593048-96593070 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1112177014 13:97035785-97035807 AAGAGTTACTGGCCCTAAAGAGG + Intergenic
1112866032 13:103899292-103899314 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
1112901330 13:104361665-104361687 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1113217784 13:108062387-108062409 AAGAATTATTGGCCATAAAGAGG + Intergenic
1113558828 13:111260140-111260162 AGGAGTTATTGGCCTTAAGGAGG + Intronic
1114994210 14:28327559-28327581 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1115381442 14:32744722-32744744 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1115809980 14:37096479-37096501 AAGAATTATTGGCCTTAAAGAGG - Intronic
1115821161 14:37213600-37213622 AAGAGGTATTGGCCTTAAAGAGG + Intronic
1115861368 14:37689347-37689369 AAGTGTTATTGGCCTTAAAGAGG + Intronic
1115930299 14:38483690-38483712 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1115948817 14:38696070-38696092 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1116085703 14:40235459-40235481 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1116154869 14:41190416-41190438 TAGAGTTATTGGCCTTAAAGAGG + Intergenic
1116192764 14:41681145-41681167 AAGAGTTATTGGCCTTAGAGAGG + Intronic
1116220741 14:42084407-42084429 AAGAGTTATCGGCCTTAAAGAGG - Intergenic
1116506808 14:45693016-45693038 AAGAGTTATTGGCCTTACAGAGG - Intergenic
1116889294 14:50251401-50251423 AAGAGTTATTGGCCTAAAAGAGG + Intronic
1117110509 14:52448077-52448099 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1117159203 14:52972262-52972284 AAGAGTTATGGGCCTTAAAGAGG - Intergenic
1117504306 14:56387282-56387304 AAGAGTTATTGGCCTTGAAGAGG - Intergenic
1117795237 14:59387079-59387101 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1117842846 14:59879310-59879332 AAGAGTTATTGGCCTTAAGGAGG - Intergenic
1118034052 14:61847672-61847694 CAGAGTTATTGGCCATAAAGAGG - Intergenic
1118099040 14:62574341-62574363 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1118240954 14:64058470-64058492 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1118543703 14:66860003-66860025 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1119083626 14:71720258-71720280 AAGAATTATTGGCCCTAAAGAGG - Intronic
1120107484 14:80513579-80513601 AAGAGTTTTTGGCCTTAAAGAGG - Intronic
1120715317 14:87835147-87835169 AAAAGTCAATGGCCTTAATGGGG - Intergenic
1120808366 14:88776963-88776985 AGGAGTTACTGGCCTTAAAGAGG + Intronic
1121153138 14:91655721-91655743 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1121376127 14:93412314-93412336 AACAGTTATTGGCCTTAAAGAGG + Intronic
1121758996 14:96427730-96427752 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1124037298 15:26066443-26066465 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1124844095 15:33273954-33273976 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1125044326 15:35229158-35229180 AAGAGTAATTGGCCTTAAAGAGG - Intronic
1125272473 15:37954095-37954117 AAGAGTTACTGGCCTTAAAGGGG + Intronic
1125276821 15:38002457-38002479 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1125565991 15:40678759-40678781 AAGAGTTATTGGCCTGAAAGAGG - Intergenic
1125566263 15:40681106-40681128 AAGAGTTACTGGCCTTAAAAGGG - Intergenic
1125877694 15:43165173-43165195 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1126053054 15:44705164-44705186 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1126216413 15:46159354-46159376 AAGAGTTATTTGCCTTAAAGAGG + Intergenic
1126247062 15:46519333-46519355 AACAGTTATTGGCCTTAAAGAGG + Intergenic
1126250631 15:46564269-46564291 AAGCATTATTGGCCCTAAAGAGG - Intergenic
1126294834 15:47128371-47128393 AAGAGCTATTGGCCTTAAAGAGG - Intergenic
1126488982 15:49215340-49215362 AAGAGTTATTGGCTTTAAAGAGG - Intronic
1127022455 15:54763597-54763619 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
1127155567 15:56121638-56121660 AAGAGCTATTGGCCTTAAAGAGG - Intronic
1127837642 15:62803422-62803444 AAGAGTTATTGGCCTTAAAAAGG - Intronic
1127971331 15:63964561-63964583 AAGAGTTATTGGCCCCAATGAGG - Intronic
1128364659 15:66989548-66989570 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1129736027 15:77964413-77964435 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1129835294 15:78701302-78701324 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1130400183 15:83545135-83545157 AAGAGTTATTGACCTTAAAGAGG - Intronic
1130511980 15:84596988-84597010 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1131945080 15:97610577-97610599 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1133833717 16:9348952-9348974 AAGAGTTACTGGCCTCAAAGAGG - Intergenic
1136464247 16:30430853-30430875 CAGAGATAGTAGCCCTAATAAGG - Intergenic
1137225861 16:46507729-46507751 AAGAGTTAATGGCCTTAGAGAGG + Intergenic
1138756523 16:59493003-59493025 GAGACATAGTGGCCATAATGGGG + Intergenic
1138844787 16:60552806-60552828 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1138957971 16:61994178-61994200 AAGAGTGAATGGCACAAATGAGG - Intronic
1140157920 16:72453595-72453617 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1140566932 16:76054695-76054717 AAGAGTTATTGGCCTTAAGGCGG - Intergenic
1141037489 16:80640982-80641004 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1141485385 16:84335687-84335709 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1142919759 17:3173973-3173995 AAGAGTGATTGGCCTTAAAGAGG + Intergenic
1143257140 17:5568165-5568187 AAGAGTTATTGGCCTTAAGGAGG - Intronic
1143431440 17:6890054-6890076 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1143780962 17:9229577-9229599 CAGAGTCAGTGGCCCCGATGGGG - Intronic
1146242362 17:31242412-31242434 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1149054468 17:52346542-52346564 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1149239944 17:54637057-54637079 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1150871205 17:68912476-68912498 AAGAGTCATTGGCCTTAAGGAGG + Intronic
1152909531 17:82992090-82992112 AAGAGTTATTGGCCCTAAAAAGG + Intronic
1152919444 17:83058694-83058716 ATGAGTCCGTGGCTCTAATGTGG + Intergenic
1152958540 18:62755-62777 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1153075146 18:1154603-1154625 AAGAGTTATTGGCCTTAGTGAGG - Intergenic
1153099776 18:1453159-1453181 AAGAGTTATTGCCCTTAAAGAGG + Intergenic
1153363504 18:4225830-4225852 AAGAGTTATTGGCCTTAAAAAGG + Intronic
1153388742 18:4531211-4531233 AAGAGTTATTGGACTTAAAGAGG - Intergenic
1154386759 18:13899394-13899416 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1155282314 18:24252102-24252124 CAGTGTTACTGGCCCTAAAGAGG + Intronic
1156572607 18:38275525-38275547 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
1157022568 18:43804425-43804447 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1157161666 18:45319149-45319171 GAGAGTCAGTGGTCCTAAAGAGG - Intronic
1157879490 18:51306338-51306360 AAGAGTTATTGGCATTAAGGAGG + Intergenic
1157937151 18:51885430-51885452 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1158468789 18:57715398-57715420 AAGAGTTATTGGCATTAAAGTGG + Intronic
1159091857 18:63859092-63859114 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1159243406 18:65773717-65773739 AAAAGTTAGTGAGCTTAATGAGG + Intronic
1159260647 18:66007427-66007449 AAGAGTTATTGACCGTAAAGTGG + Intergenic
1159284749 18:66335299-66335321 AAGAGTTATTGGCCTTAGAGAGG - Intergenic
1159718547 18:71856518-71856540 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1159896317 18:74000258-74000280 AAGAGTTACTGGCTTTAAGGAGG - Intergenic
1164456961 19:28416743-28416765 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1166408088 19:42537809-42537831 AAAAGTTATTGGCCTTAAAGAGG - Intronic
925269601 2:2593115-2593137 TAGAGTTATTGGCCTTAAAGAGG + Intergenic
927569986 2:24151037-24151059 AAGAGTTATTGGCCTTACAGGGG - Intronic
928459056 2:31452524-31452546 AAGAATTATTGGCCTTAAAGAGG + Intergenic
928495504 2:31827810-31827832 AAGAGATATTGGCCTTAAAGAGG - Intergenic
928609745 2:32981189-32981211 AAGAGTTACTGACCTTAAAGAGG - Intronic
928846191 2:35676031-35676053 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
929206610 2:39302708-39302730 AAAAGTTAGTAGCACTAATCAGG + Intronic
929926394 2:46215690-46215712 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
930141725 2:47957453-47957475 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
930294481 2:49537357-49537379 AAGAGTTATTGGTCTTCATGAGG + Intergenic
930475608 2:51877268-51877290 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
930527673 2:52550056-52550078 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
930582052 2:53223631-53223653 AATAGTTTGTGGCAATAATGGGG + Intergenic
930878147 2:56243246-56243268 AAGAGTTATTGGCTTTAAAGAGG - Intronic
930895239 2:56438782-56438804 AAGAGTTATTGGGCTTAAAGAGG - Intergenic
930981088 2:57527174-57527196 AAGAGTTATTGGCCCTAATGAGG - Intergenic
931568848 2:63647018-63647040 AAGAATTAATGGCCTTAAAGAGG - Intronic
931572442 2:63682567-63682589 AAGAGTTATTGGCCTTAAAGAGG + Intronic
932303270 2:70683606-70683628 ATGAGTTTGAGGCCCTCATGAGG - Exonic
932858607 2:75265497-75265519 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
933227361 2:79766640-79766662 AAGAATTAATGGCCTTAAAGAGG - Intronic
933601156 2:84331782-84331804 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
934870758 2:97862763-97862785 AAGAGTTAATGGCCTTAAAGAGG + Intronic
935437707 2:103054742-103054764 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
935751099 2:106234610-106234632 AAGAGTTGTTGGCCTTAAAGAGG + Intergenic
936511083 2:113147899-113147921 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
936794798 2:116192487-116192509 AAGAGTTATTGGTCTTAACGAGG - Intergenic
937591391 2:123616821-123616843 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
939257073 2:139758356-139758378 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
939913184 2:148007599-148007621 AAGAGTTACTGGCCTTAAAGAGG + Intronic
940425556 2:153527071-153527093 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
940443786 2:153752858-153752880 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
940503607 2:154526023-154526045 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
940738647 2:157481686-157481708 AAGAGTTACTGGCCTTAAAGAGG + Intronic
940803205 2:158155617-158155639 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
940947930 2:159638782-159638804 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
941227825 2:162870082-162870104 AAGAATTATTGGCCCTGAAGAGG + Intergenic
942391618 2:175501079-175501101 AAGAGTTATTGACCTTAAAGAGG - Intergenic
942769274 2:179496371-179496393 AAGAGTTATTGGCCTTAAAGGGG + Intronic
942862970 2:180637582-180637604 AAGAGTTATTGGCCTTAAAGGGG + Intergenic
942915165 2:181296014-181296036 AAGAGTTATTGACCTTAAAGAGG + Intergenic
943226626 2:185186544-185186566 AAGAGATATTGGCCTTAATGTGG - Intergenic
944005112 2:194895634-194895656 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
944377169 2:199059117-199059139 AAGAGATATTGGCCTTAAAGAGG + Intergenic
944760615 2:202809870-202809892 AAGAGTTATTGGCTTTAAAGAGG + Intronic
944963193 2:204900223-204900245 AAGAGTTATTGGCCTTAAAGAGG - Intronic
944990336 2:205228718-205228740 AAGAGTTATTGGCCTTAAAGAGG - Intronic
945575829 2:211526975-211526997 AAGAGTTATTGGCCTTAATGAGG + Intronic
945739542 2:213643621-213643643 AAGAGTTATTGGCCATAAAGAGG - Intronic
946508913 2:220333535-220333557 AGGAGTTATTGGCCTTAAAGAGG - Intergenic
946984881 2:225259792-225259814 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
947008976 2:225545298-225545320 AAGAGTGATTGGCCTTAAAGAGG - Intronic
947505060 2:230702150-230702172 AAGAGTTGCTGGCCTTAAAGAGG - Intergenic
1168743978 20:220310-220332 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1168899827 20:1353971-1353993 AAGAGTTACTGGCCATAAAGAGG - Intronic
1168917061 20:1498713-1498735 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1169617758 20:7469663-7469685 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1169628847 20:7602111-7602133 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1169942674 20:10954192-10954214 AAGAGTTTTTGCCTCTAATGGGG - Intergenic
1170086789 20:12543052-12543074 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1171819548 20:29821972-29821994 AAGTGTTATTGGCCTTAAAGAGG - Intergenic
1171898283 20:30831210-30831232 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1172419177 20:34799364-34799386 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1172825878 20:37785374-37785396 AATAGTTACTGGCCTTAAAGAGG - Intronic
1172934276 20:38608675-38608697 CAAATTTAGTGGCCCTAATTTGG + Intronic
1174536643 20:51256382-51256404 AAGAGTTGCTGGTCCTAGTGGGG + Intergenic
1174708235 20:52678712-52678734 AGGAGTTTGTGGACCAAATGTGG - Intergenic
1174938735 20:54899932-54899954 AAGAATTATTGGCCTTAAAGAGG + Intergenic
1175632006 20:60549003-60549025 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1176917734 21:14646044-14646066 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1177023925 21:15897510-15897532 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1177592373 21:23186851-23186873 AAGAGTGACTGGCCTTAAAGTGG + Intergenic
1177771490 21:25520759-25520781 AAGAGTTATTGGCCTTAAAGGGG + Intergenic
1179396006 21:41040469-41040491 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1180323532 22:11346666-11346688 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1182178889 22:28323647-28323669 AAGAGTTATTAGCCTTAAAGAGG + Intronic
1183470798 22:38005431-38005453 AAGAGTTGGGAGTCCTAATGGGG + Intronic
949428675 3:3948145-3948167 AACAGTTATTGGCCTTAAAGAGG - Intronic
949448326 3:4160168-4160190 AAGAGTTATTGGCCTTAAAGAGG - Intronic
949452673 3:4204591-4204613 AAGAGTTACTGGCCTTAAAGAGG - Intronic
949622929 3:5836428-5836450 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
949903983 3:8843252-8843274 AGGAGTTTTTGGCCCTACTGAGG + Intronic
950529399 3:13544514-13544536 AAGGGTATGTGGCCCTAGTGAGG - Intergenic
950800498 3:15548270-15548292 AAAAGTTATTGGCCCTAAAGAGG - Intergenic
951032070 3:17894026-17894048 AAGATTTATTGGCCTTAAAGAGG - Intronic
951040507 3:17983935-17983957 AAGAGTTTGTGGCCAGAATGGGG - Intronic
951259739 3:20494022-20494044 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
951436807 3:22675027-22675049 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
951494842 3:23315065-23315087 AAGAGTTACTGCCCTTAAAGAGG - Intronic
951929627 3:27950820-27950842 AATAGTTATTGGCCTTAAAGAGG - Intergenic
951972930 3:28468342-28468364 AACAGTTATTGGCCTTAAAGAGG + Intronic
952139660 3:30464757-30464779 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
952202968 3:31150267-31150289 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
952566978 3:34670541-34670563 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
952772119 3:37011214-37011236 AAGAGATTGTGGGCCGAATGTGG + Intronic
952811670 3:37409830-37409852 AAGATTTATTGGCCTTAAAGAGG - Intronic
953063401 3:39447329-39447351 AAGAGATAATGGCCCAAGTGGGG + Intergenic
953217384 3:40932136-40932158 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
953362260 3:42308236-42308258 AAGAGTTATTGGCCTTGAGGAGG - Intergenic
953722847 3:45371269-45371291 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
955274187 3:57531946-57531968 AAGAGTAATTGGCCTTAAAGAGG - Intronic
955531197 3:59874796-59874818 AAGAGCTTGTGGCTCTAAAGGGG - Intronic
955585045 3:60469264-60469286 AAGAGTTATTGGCCTTAAAGAGG - Intronic
957087410 3:75693983-75694005 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
957753967 3:84463037-84463059 AAGAGTTATTGGCTCTAAAAAGG + Intergenic
957925621 3:86806545-86806567 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
957966296 3:87324987-87325009 AAGAGTTATTGGCCTTTAAGAGG + Intergenic
958174760 3:89982923-89982945 AAGAGTCAGTGGCCTTAAGGAGG - Intergenic
958174849 3:89984295-89984317 AAGAGTCACTGGCCTTAAGGAGG + Intergenic
958617698 3:96516191-96516213 AAGAGTTATTGGCCTTAACGAGG + Intergenic
958631044 3:96684417-96684439 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
958683007 3:97354635-97354657 AAGAATTATTGGCCTTAAAGAGG + Intronic
959113567 3:102149562-102149584 AAGAGTAATTGGCCTTAAAGAGG + Intronic
959414184 3:106063297-106063319 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
959462825 3:106648355-106648377 AAGAGTTAGTGGGCACAATTGGG - Intergenic
959646104 3:108703584-108703606 AGGAGTTATTGGCCTTAAAGAGG - Intergenic
959868373 3:111298650-111298672 AAGAGTTACTGACCTTAAAGAGG - Intronic
960095320 3:113684467-113684489 AAGAGTTATTGGTCTTAAAGAGG - Intronic
960565117 3:119124697-119124719 AAGAGTTATTGGCGTTAAAGAGG + Intronic
960792415 3:121448125-121448147 AAGAGTTATTGGCCTTAAAGAGG - Intronic
961986411 3:131139420-131139442 AAGAGTTATTGGCCTTAAAGAGG + Intronic
962017295 3:131454802-131454824 AAGGGAGAGTGGCCCTGATGAGG + Intergenic
962078568 3:132113138-132113160 AAGAGTTATTGGTCTTAAAGAGG - Intronic
962193759 3:133338087-133338109 AAGAGTTATTGGCCTTAAAGAGG + Intronic
962584662 3:136830031-136830053 CAGAGTTATTGGCCTTAAAGAGG - Intronic
962688545 3:137870319-137870341 AACAGTTATTGGCCTTAAAGAGG + Intergenic
962767785 3:138581365-138581387 AAGAGTTATTGGCCTTAAAGAGG + Intronic
963310271 3:143701693-143701715 AAGAGTTATTGGCCTTAAAGAGG + Intronic
963330697 3:143911487-143911509 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
963354677 3:144196474-144196496 AAGAGTTATTGGCTCGAAAGAGG - Intergenic
963434324 3:145248953-145248975 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
963528551 3:146445758-146445780 AAGAGTTATTTGTCCTAAAGAGG - Intronic
963692429 3:148520804-148520826 AAGAGTTATTGACCTTAAAGAGG + Intergenic
963701577 3:148632304-148632326 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
964059417 3:152504002-152504024 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
964179572 3:153866818-153866840 AAGAGTTCGTGGCCTTAAAGAGG + Intergenic
964239645 3:154576108-154576130 AAGAGTTATTGCCCTTAAAGAGG + Intergenic
964339148 3:155689809-155689831 AAAAGTTATTGGCCTTAAAGAGG + Intronic
964398270 3:156271295-156271317 AAGAGTTATAGGCCCTAAAAAGG - Intronic
964582720 3:158258657-158258679 AAGCGTTATTGGCCTTAAAGAGG - Intronic
964767478 3:160192645-160192667 AAGAGTCAATGGCCCAGATGAGG - Intergenic
964804239 3:160589083-160589105 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
964810257 3:160655512-160655534 AAGAGTGATTGGCCTTAAAGAGG + Intergenic
964961204 3:162428704-162428726 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
965014419 3:163139029-163139051 AAGAGGTATTGGCCTTAAAGAGG - Intergenic
965044280 3:163553962-163553984 AAGAGTTATTGGCTGTAAAGAGG - Intergenic
965273859 3:166654771-166654793 AAGACTTACTGGCCTTAAAGAGG + Intergenic
965349204 3:167593214-167593236 AAGAGTTATTGGACTTAAAGAGG - Intronic
965358862 3:167711546-167711568 AAGAGTTACTGGCATTAAAGAGG + Intronic
965464509 3:169011129-169011151 AAGAGTTATTGGCCTTAAATAGG - Intergenic
965464526 3:169011360-169011382 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
965527037 3:169731829-169731851 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
965844750 3:172948013-172948035 AAGAGTTATTGGCTTTAAAGAGG + Intronic
966329155 3:178791511-178791533 AAGAGTTATTGGCCTTAAGGAGG + Intronic
966468287 3:180257187-180257209 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
967677657 3:192318614-192318636 AAGAGTTGTTGGCCTTAAGGAGG + Intronic
968004782 3:195234971-195234993 AAGAGTTACTGGCTTTAAAGAGG - Intronic
968428954 4:543629-543651 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
970023261 4:11592842-11592864 AGGAGTTTGTGACCCAAATGAGG + Intergenic
970442714 4:16095818-16095840 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
970821696 4:20223645-20223667 AAGAGTTATTGGCATTAAAGAGG - Intergenic
971665015 4:29472253-29472275 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
972103988 4:35460240-35460262 AAAAGTTACTGGCCTTAAAGTGG - Intergenic
972270624 4:37508318-37508340 AAAAGTTATTGGTCCTAAAGAGG - Intronic
972468510 4:39382084-39382106 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
972843377 4:42957537-42957559 AAGAGTTATTGGCCTTAAAGTGG - Intronic
972856703 4:43115553-43115575 AAGAGTTACTGGTCTTAAAGAGG + Intergenic
972902574 4:43702726-43702748 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
973852921 4:54978834-54978856 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
974301181 4:60068767-60068789 AAGAGTTATTGGACTTAAAGAGG + Intergenic
974559380 4:63496790-63496812 AAGAGATATTGGCCTTAAAGAGG + Intergenic
974593105 4:63981956-63981978 AAGAGTTATTGACCTTAAAGAGG - Intergenic
974597096 4:64028759-64028781 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
974893084 4:67905949-67905971 AAGAGTTTTTGGCCTTAAAGAGG - Intergenic
975252891 4:72199660-72199682 GAGAGTTATTGGCCTTAAAGAGG + Intergenic
975335640 4:73171948-73171970 AAAAGTTATTGGCCTTAAAGAGG + Intronic
975502097 4:75098651-75098673 AAGAGTTATTGACCTTAAAGAGG - Intergenic
975675078 4:76819803-76819825 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
976029872 4:80739790-80739812 AAGAGTTCCTGGCCTTAATGAGG - Intronic
976041244 4:80887109-80887131 AAGAATTATTGGCCTTAAAGAGG + Intronic
976171453 4:82309237-82309259 CAGAGTTATTGGCCTTAAAGTGG - Intergenic
976451647 4:85197936-85197958 AAGAGTTTTTGGCCTTAAAGAGG - Intergenic
976453774 4:85222257-85222279 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
976574417 4:86652855-86652877 AAGAATTATTGGCCTTAAAGAGG - Intronic
976722234 4:88179966-88179988 AAGAGTTATTGGCCTTAAAGAGG + Intronic
976728325 4:88238532-88238554 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
976762668 4:88567394-88567416 AAGAGTTATTGGCCTTAAAGAGG - Intronic
977185055 4:93926415-93926437 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
977307622 4:95343971-95343993 AAGAGTTATTGGCCTTAAAGAGG + Intronic
977458509 4:97295350-97295372 AAGAGTTTTTGGCCTTAAGGAGG - Intronic
977502442 4:97858074-97858096 AAGAGTTATTGGCCATACAGAGG + Intronic
977854884 4:101877080-101877102 AGGGGTTAGTGGCCTTAAGGAGG + Intronic
977873464 4:102122136-102122158 AAGAGTCATTGGCCTTAAAGAGG - Intergenic
978031094 4:103940605-103940627 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
978212507 4:106155494-106155516 AAGAGTTACTGGACTTAAAGAGG - Intronic
978297771 4:107227785-107227807 AAGAGTTATTGGCCTTACAGAGG + Intronic
978520234 4:109607999-109608021 AAGAGTTATTGGCCTTGAAGAGG - Intronic
978651639 4:111012692-111012714 AGAGGTTAGTGGCCCTATTGAGG + Intergenic
979564908 4:122144282-122144304 AAGAGTTATTGGCCTCAAGGAGG - Intergenic
979946001 4:126831733-126831755 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
980168967 4:129263735-129263757 AAGAGTTAAAAGCCCTGATGTGG + Intergenic
980597084 4:134968171-134968193 AAGAGTTAGTGGCCTTAAAAAGG + Intergenic
980683084 4:136188729-136188751 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
981140404 4:141260848-141260870 AAGAGTTATTGGCCTTTAAGGGG + Intergenic
981154789 4:141422211-141422233 AAGAGCTATTGGCCTTAAAGAGG - Intergenic
981203611 4:142013813-142013835 AAGAATTACTGGCCTTAAAGAGG - Intergenic
981394867 4:144235462-144235484 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
981518083 4:145632616-145632638 AAGAGCTATTGGCCTTAAAGAGG - Intronic
981895818 4:149797449-149797471 AAGAGTTCTTGGCCTTAAAGAGG + Intergenic
983050386 4:163039272-163039294 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
983165797 4:164476207-164476229 ATGAGTTATTGGCCTTAAAGAGG - Intergenic
983389083 4:167104616-167104638 AAGAGTTATTGCCCTTAAAGGGG + Intronic
983456430 4:167970166-167970188 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
983493297 4:168413763-168413785 AAGATTTATTGGCCTTAAAGGGG + Intronic
984310448 4:178051742-178051764 AAGAGTCATTGGCCCTAAAGAGG - Intergenic
984424784 4:179569359-179569381 AAGAATTATTGGCCTTAAAGAGG - Intergenic
985229658 4:187800753-187800775 AAGGGTTATTGGCCTTAAGGAGG + Intergenic
986046795 5:4045928-4045950 AAGAGGTATTAGCCCTAAAGAGG + Intergenic
986492898 5:8310229-8310251 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
986630990 5:9774030-9774052 AGGAGTTAGTGGTCTTAAAGAGG - Intergenic
986885062 5:12224645-12224667 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
987823262 5:22992804-22992826 AAGAGTTGCTGGCCTTAAAGAGG + Intergenic
987848746 5:23322162-23322184 AAGAGGAAGTAGACCTAATGTGG - Intergenic
988340283 5:29961628-29961650 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
988608162 5:32700307-32700329 AAGAGTTACTGGCCTTAAAGAGG - Intronic
988939577 5:36129136-36129158 AAGAGTTCTTGGCCTTAAAGAGG + Intronic
989083105 5:37646979-37647001 AAGAGTTATTGGCCTTAAAGAGG - Intronic
989312343 5:40034659-40034681 AAGAGTCAGTGACCACAATGAGG - Intergenic
989504672 5:42214108-42214130 AAAAGTTATTGGCCCTACGGAGG - Intergenic
989690832 5:44142096-44142118 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
989970582 5:50520012-50520034 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
990923645 5:60994802-60994824 AAGAGTTACTGGCCTTAATGAGG - Intronic
991169423 5:63603939-63603961 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
991180429 5:63745394-63745416 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
991395076 5:66196826-66196848 AAGAGTTATTGACCATAAAGTGG - Intergenic
992345369 5:75870541-75870563 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
992692482 5:79254754-79254776 AAGAGTTATTGGCCTTAATGAGG - Intronic
992934693 5:81689251-81689273 AAGAGTTATTGGCTGTAAAGAGG + Intronic
993473677 5:88337412-88337434 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
993623490 5:90194553-90194575 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
993677493 5:90834757-90834779 AAGAGGTATTGGCCTTAAAGGGG - Intronic
994217680 5:97157728-97157750 TAGAGTTATTGGCCTTAAAGAGG - Intronic
994229405 5:97296658-97296680 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
994319961 5:98382887-98382909 AAGAATTATTGGCCTTAAAGAGG - Intergenic
994428564 5:99626817-99626839 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
994477463 5:100289324-100289346 AAGAGATACTGGCCTTAAAGAGG - Intergenic
994531091 5:100972209-100972231 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
994633788 5:102319360-102319382 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
994893409 5:105669078-105669100 GAGAGTTATTGGCCTTAAAGAGG - Intergenic
995268486 5:110193557-110193579 AAGAGTTATTGGCCCTAAAGAGG - Intergenic
995432041 5:112090254-112090276 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
995557721 5:113346252-113346274 AAGAGGTATTGGCCTTAAAGAGG + Intronic
995697616 5:114898178-114898200 AAGTGTTATTGGCCTTAAGGAGG - Intergenic
996116246 5:119623247-119623269 AAGAGTTGTTGGCCTTAAAGAGG - Intronic
996161797 5:120175156-120175178 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
996820821 5:127625141-127625163 GAGAGTCAGTGCCCCTGATGGGG - Intergenic
996961357 5:129254208-129254230 AAGAGTTATTGACCTTAAAGAGG - Intergenic
996962326 5:129265975-129265997 AATAGTTATTGGCCTTAAAGAGG + Intergenic
997158606 5:131583708-131583730 TTGAGTAAGTGGCCCTAAGGTGG - Intronic
997180436 5:131823300-131823322 AAGAGTTATTGGTCTTAAAGAGG - Intronic
997832839 5:137165943-137165965 AAGAGTTATTGGCCTTAAAGAGG + Intronic
998634189 5:143933863-143933885 AAGAGTTACTGGCCTTAGAGAGG + Intergenic
998695383 5:144632253-144632275 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
999452531 5:151689063-151689085 TAGATTGAGTGGCCCTAAGGAGG - Intergenic
999919349 5:156302120-156302142 AAGAGTTATTGGCCTTACAGAGG - Intronic
1000455109 5:161438934-161438956 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1000651154 5:163820758-163820780 AAGAGTTATTGGCCATAAAGAGG - Intergenic
1000701892 5:164461535-164461557 ATGAATTAGTGGCCCTTATGGGG + Intergenic
1000776460 5:165426006-165426028 AAGAGTTAGTATCCCTGCTGAGG - Intergenic
1001177834 5:169488294-169488316 AAGAGGTATTGGCCTTAAAGAGG + Intergenic
1001306817 5:170580800-170580822 AAGAGTTACAAGGCCTAATGAGG + Intronic
1002339147 5:178503494-178503516 TAAAGTTAGTGACCTTAATGTGG + Intronic
1005037223 6:21568069-21568091 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1006018324 6:31101131-31101153 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1006554010 6:34850468-34850490 AAGAATTATTGGCCTTAAGGAGG - Intronic
1006963908 6:37962375-37962397 AAGAGTTACTGGGCTTAAAGGGG + Intronic
1007001429 6:38317604-38317626 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1008192542 6:48477051-48477073 AAGAGTTAATGGCCTTAAAGAGG + Intergenic
1008239075 6:49085944-49085966 AAGAGTTTTTGGCCTTAAAGAGG + Intergenic
1008250193 6:49230689-49230711 AAGAGTTATTGGCTTTAAGGTGG - Intergenic
1008312376 6:49991574-49991596 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1008785732 6:55165197-55165219 AAGAGTTACTGGCCTTAAAAAGG + Intronic
1008882010 6:56389463-56389485 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1010264199 6:73850056-73850078 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1010403905 6:75480812-75480834 AATCTTTAGTGGCCATAATGAGG - Intronic
1010474746 6:76273602-76273624 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1010514393 6:76755052-76755074 AAGAGTCATTGGCCTTAAAGGGG + Intergenic
1010529074 6:76943625-76943647 AAGAGTTAGTGGCCTTAACATGG + Intergenic
1010560128 6:77339338-77339360 AAGAGTTACTGGCCTTTAAGAGG - Intergenic
1010772655 6:79849144-79849166 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1010775513 6:79880314-79880336 AAGAGTTATTGGCCCTAAAGAGG + Intergenic
1010838996 6:80624863-80624885 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1010975697 6:82311274-82311296 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1011024102 6:82846974-82846996 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
1011033374 6:82946037-82946059 AAGAGTTACAGGCCTTAAAGAGG + Intronic
1011102753 6:83742754-83742776 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1011236194 6:85219685-85219707 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1011271264 6:85581871-85581893 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1011291006 6:85777391-85777413 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1011333081 6:86232192-86232214 AAGAGTTATTGGCCATAAAGAGG - Intergenic
1011386113 6:86800491-86800513 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1011791682 6:90905891-90905913 AAGAGTTATTGGACTTAAAGGGG - Intergenic
1011901509 6:92303596-92303618 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1012288234 6:97420359-97420381 AAGAGATATTGGCCTTAATGAGG - Intergenic
1012712592 6:102627549-102627571 AAGCGTTATTGGCCTTAAAGAGG - Intergenic
1012717624 6:102697538-102697560 AAGAGTTATTGACATTAATGAGG - Intergenic
1012806950 6:103907106-103907128 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1012827511 6:104164367-104164389 AAGACTTATTGGCCTTAAAGAGG + Intergenic
1012892282 6:104909760-104909782 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1012940656 6:105411162-105411184 AAGAGTTGTTGGCCTTAAAGAGG + Intergenic
1013908714 6:115248115-115248137 AAGAGTTATTAGCCTTAAAGTGG + Intergenic
1013925461 6:115466906-115466928 AAGAGTTATTGGCCTCAAAGAGG - Intergenic
1014176374 6:118335804-118335826 AAGATGGAGTGGCACTAATGAGG - Intergenic
1014186744 6:118443858-118443880 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1014583209 6:123163309-123163331 AAGAATTATTGGCCTTAAAGAGG + Intergenic
1014627988 6:123752855-123752877 AAGAGTTAGAGACATTAATGAGG + Intergenic
1014862440 6:126486058-126486080 AAGAGTTACTGGCCTTAATAGGG + Intergenic
1015030475 6:128588164-128588186 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1015460892 6:133489285-133489307 AAGAGTTATTGGCCTTAAACAGG + Intronic
1015578605 6:134700017-134700039 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1016054400 6:139564500-139564522 AAGAGTTATTGGTCCTAAAGAGG - Intergenic
1016185573 6:141194497-141194519 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1016229969 6:141790647-141790669 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1016251726 6:142050568-142050590 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1016623645 6:146141498-146141520 AAGAGTTTTTGGCCTTAAAGAGG - Intronic
1017387534 6:153903033-153903055 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1017398019 6:154026549-154026571 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1017491428 6:154948939-154948961 AAGACTTATTGGCCTTAAAGAGG - Intronic
1020515172 7:9108424-9108446 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1020574668 7:9911826-9911848 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1020613100 7:10425839-10425861 AAGAGTTACTGGTCTTAAAGAGG - Intergenic
1020624397 7:10559506-10559528 AAGAGTTATTGGCCTTAAACAGG + Intergenic
1020894128 7:13918040-13918062 AAGAGATAGTGGTTTTAATGTGG + Intronic
1021123907 7:16827795-16827817 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1021214420 7:17899422-17899444 AAGAGTTATTGTCCTTAAAGAGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021641158 7:22737247-22737269 AAGAGTTATTGGACTTAAAGAGG + Intergenic
1021842843 7:24734828-24734850 AAGAGGTATTGGCCTTAAAGAGG + Intronic
1021884701 7:25127298-25127320 AAGAGTTACTGGCCATAAAGAGG - Intergenic
1022080391 7:27014113-27014135 ATGAGTTATTGGCCTTAAAGAGG + Intergenic
1022223417 7:28338729-28338751 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1022348419 7:29540591-29540613 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
1023208791 7:37781014-37781036 AAGAGTTATTGGCCTTAATAAGG - Intronic
1024368891 7:48557910-48557932 AAGAGTTATTGACCTTAAAGTGG - Intronic
1024661089 7:51496072-51496094 AAGAGTTATTGGCCTCAAAGAGG - Intergenic
1024705724 7:51957877-51957899 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1025800102 7:64778773-64778795 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1027605065 7:80289491-80289513 AATAGTTATTGGCCTTAAAGAGG + Intergenic
1027808423 7:82860102-82860124 AATAGTTATTGGCCTTAAAGAGG + Intronic
1028001544 7:85503511-85503533 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1028169602 7:87580665-87580687 AAGAGTTATTGGCCTTAAATAGG - Intronic
1028281517 7:88935588-88935610 AAGACTTTCTGACCCTAATGTGG - Intronic
1028284505 7:88979826-88979848 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1028521822 7:91740752-91740774 AAGAGTTATTGTCCTTAAGGAGG - Intronic
1028645506 7:93092326-93092348 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1029349519 7:100003403-100003425 AAGAGTTGGAGGCTATAATGAGG - Intergenic
1029825479 7:103188164-103188186 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1030408129 7:109141348-109141370 GAGAGTTATTGGCCTTAAAGAGG - Intergenic
1030629495 7:111879959-111879981 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1030723683 7:112899462-112899484 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1030752679 7:113249570-113249592 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1030966474 7:115997984-115998006 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1030990486 7:116293065-116293087 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1031862452 7:126995744-126995766 AAGAGTTCTTGGCCTTAAAGAGG + Intronic
1033500075 7:141938514-141938536 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1033541813 7:142364265-142364287 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1033867615 7:145712250-145712272 AAGAGTTATTGGCATTAAAGAGG - Intergenic
1033882303 7:145901155-145901177 AAGAGTTATTGGCCTTAATCAGG - Intergenic
1034019066 7:147620773-147620795 AAGAGTTATTGGCCATAAAGAGG + Intronic
1034126385 7:148675414-148675436 AACAGTTATTGGCCTTAAAGAGG + Intergenic
1034126634 7:148677423-148677445 AAGAGTTATTGGCCTTAGAGAGG + Intergenic
1034398246 7:150843893-150843915 AAGAGTTGTTGGCCTTAAAGAGG + Intronic
1035084350 7:156245556-156245578 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1035113504 7:156504536-156504558 AAACGTTTGTGGCCCTACTGCGG + Intergenic
1035753871 8:2016534-2016556 AAGAGGTAGTGACCTTAAAGAGG - Intergenic
1037295824 8:17398582-17398604 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1037366709 8:18129978-18130000 AAGATTTATTGGCCTTAAAGAGG + Intergenic
1039002175 8:32994068-32994090 CAGAGTTATTGGCCTTAAAGAGG - Intergenic
1039640622 8:39217473-39217495 AGGAGTTATTGGCCTTAAAGAGG - Intronic
1039647303 8:39301989-39302011 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1041851758 8:62401043-62401065 AAGAGTTCTTGGCCTTAAAGAGG - Intronic
1042082377 8:65069698-65069720 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1042226928 8:66521462-66521484 AAGTGTTAGGAGCCCAAATGGGG + Intergenic
1043015798 8:74939345-74939367 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
1043042239 8:75277437-75277459 AAGAGTTACTGGCCTTCAAGAGG + Intergenic
1043134047 8:76499404-76499426 CAGAGTTATTGGCCTTAAAGAGG - Intergenic
1043367054 8:79544716-79544738 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1043554157 8:81410538-81410560 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1043600390 8:81929848-81929870 AAGAGTTATTGGCCTTACAGAGG + Intergenic
1043627152 8:82275254-82275276 AAGAGTTAATGACCTTAAAGTGG + Intergenic
1043760399 8:84061581-84061603 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1043945805 8:86251297-86251319 AAGAGTTATTGGCCTTAAATAGG - Intronic
1044192861 8:89340837-89340859 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1044635308 8:94318339-94318361 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1045041117 8:98225825-98225847 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1045147820 8:99367607-99367629 AAGAGTTATTTGCCTTAAAGTGG - Intronic
1045207607 8:100058232-100058254 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1045449247 8:102304305-102304327 AAGTGTTAGTTGCTCTAAGGAGG - Intronic
1045777287 8:105820827-105820849 AAGAGTTCTTGGCCTTAAAGAGG - Intergenic
1046267831 8:111854523-111854545 AAGAGTTACTGGACTTAAAGAGG + Intergenic
1046448549 8:114358024-114358046 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1047352241 8:124087192-124087214 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1047901277 8:129424623-129424645 AAGATTTATTGGCCATAAAGTGG + Intergenic
1050121769 9:2315522-2315544 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1050145378 9:2561537-2561559 AAGAGTTACTGGCCTTAAAAGGG + Intergenic
1050356139 9:4784177-4784199 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1050439073 9:5641535-5641557 AAGAGGTATTGGCCTTAAAGAGG - Intronic
1051923621 9:22297604-22297626 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1051992239 9:23164952-23164974 AAGAGTTATTGGGCTTAAAGAGG + Intergenic
1052258588 9:26489138-26489160 AAGAGTTACTGGCGTTAAAGAGG - Intergenic
1052420403 9:28235857-28235879 AAGAGTTATTGACCGTAAGGAGG + Intronic
1052585883 9:30426737-30426759 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1052607613 9:30724519-30724541 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1053750859 9:41253008-41253030 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1054256374 9:62817350-62817372 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1054334935 9:63798263-63798285 AAGAGTCATTGGCCTTAAAGAGG - Intergenic
1054956410 9:70915765-70915787 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1054982759 9:71224989-71225011 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1055910983 9:81350917-81350939 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1056339005 9:85605017-85605039 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1057288893 9:93787431-93787453 GAGAGTTATTGGCCTTAAGGAGG - Intergenic
1058418471 9:104812622-104812644 AACAGTTTGTGGCCCTTTTGTGG - Exonic
1058522655 9:105827684-105827706 AAGACTTATTGGCCTTAAAGTGG - Intergenic
1058767968 9:108200228-108200250 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1059094783 9:111400796-111400818 AAGAGTTATTTGCCTTAAAGAGG + Intronic
1059515559 9:114891016-114891038 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1059555283 9:115274796-115274818 AAGAGTTATTGGCCTTAACGAGG - Intronic
1060126971 9:121056753-121056775 AAGAGTTACTAGCCTTAAAGGGG + Intergenic
1060166520 9:121421630-121421652 AAGAGTTGCTGGCCTTAAAGAGG - Intergenic
1062739507 9:138160858-138160880 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1203371213 Un_KI270442v1:307239-307261 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1186911457 X:14172491-14172513 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1187315054 X:18185181-18185203 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1187613040 X:20962787-20962809 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1187651888 X:21419014-21419036 AAGAGTTATTGCCCTTAATCAGG - Intronic
1187889315 X:23919182-23919204 AAGAATTATTGGCCCTAAAAAGG - Intronic
1188068632 X:25693340-25693362 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1188071596 X:25725146-25725168 AAGAATTACTGGCCTTAAAGAGG - Intergenic
1188210794 X:27420831-27420853 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1188579088 X:31687995-31688017 AAGAGTTATTGGCCTTAAACAGG - Intronic
1188716173 X:33462527-33462549 AAGAGTCATTGGCCTTAAGGAGG - Intergenic
1188814341 X:34693055-34693077 AAGAGTTACTGGCCTAAAAGAGG - Intergenic
1188815151 X:34704305-34704327 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1188840531 X:35011530-35011552 AAGAATTATTGGCCATAAAGAGG + Intergenic
1188854093 X:35170928-35170950 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1188924457 X:36022582-36022604 AAGAGTTACTGCCCTTAAAGAGG - Intergenic
1188930056 X:36097923-36097945 AAGAGTTACTGGCCTTACAGAGG - Intronic
1188972147 X:36631390-36631412 AAGAGTTATTGGCCTTAAACAGG - Intergenic
1189628365 X:42923001-42923023 AAGAGTTATTGGTCTTAAAGGGG + Intergenic
1189640970 X:43069640-43069662 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1189690343 X:43611414-43611436 AAGAGTTATTGGCTTTAAAGTGG - Intergenic
1189868636 X:45359117-45359139 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1189870194 X:45373101-45373123 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1189875497 X:45432353-45432375 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1189881327 X:45496658-45496680 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1190015303 X:46821341-46821363 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1190498492 X:51052231-51052253 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
1190907728 X:54744988-54745010 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1190911857 X:54778663-54778685 AAGAGTTAGTGGCCCTAATGAGG + Intronic
1190919396 X:54837890-54837912 AAGAGTTAGTGGCCCTAAAAAGG - Intergenic
1191030726 X:55967146-55967168 AAAAGTTATTGGCCTTAAAGGGG + Intergenic
1191198759 X:57753848-57753870 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1191599967 X:62992581-62992603 AAGAGTTGGTGGCCTTAAATAGG - Intergenic
1191646783 X:63489913-63489935 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1191774976 X:64803720-64803742 AAGATTTATTGGACTTAATGTGG + Intergenic
1191781716 X:64875500-64875522 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1191800100 X:65069238-65069260 AACAGTTATTGGCCTTAAAGAGG - Intergenic
1191813536 X:65217830-65217852 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1191827079 X:65377295-65377317 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1191950010 X:66580403-66580425 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1191973990 X:66850090-66850112 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1192027348 X:67467818-67467840 AAGAGTTATTGGCTGTAAAGAGG + Intergenic
1192062320 X:67840240-67840262 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1192088200 X:68122878-68122900 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1192680103 X:73243408-73243430 AAGAGTTACTGGCCTTAAAAAGG + Intergenic
1192707044 X:73537592-73537614 AAGAGTCAGGGTCACTAATGTGG + Intergenic
1192714613 X:73626406-73626428 AAGAGTTATTGGCCTTAAAAAGG - Intronic
1192858329 X:75038516-75038538 AAGAGATAATGGCCCTGAAGAGG - Intergenic
1192891095 X:75391250-75391272 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1192968405 X:76204959-76204981 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1192992765 X:76479301-76479323 AAGAGTTATTGGCTTTAACGAGG - Intergenic
1193005104 X:76607712-76607734 TAGAGTTATTGGCCTTAATTAGG + Intergenic
1193078889 X:77384562-77384584 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1193092745 X:77511851-77511873 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1193163389 X:78255550-78255572 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1193192688 X:78591408-78591430 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193204691 X:78734982-78735004 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193243120 X:79196131-79196153 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
1193247502 X:79245870-79245892 AAGAGTTATTGGTCATAAAGAGG + Intergenic
1193504822 X:82329300-82329322 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1193683584 X:84551578-84551600 AAGAGTCACTGGCCTTAAAGAGG - Intergenic
1193697114 X:84722654-84722676 AAAAGTTACTGGCCTTAAGGAGG - Intergenic
1193738047 X:85184439-85184461 AAGAGTTACTAGCCTTAAAGAGG - Intergenic
1193756598 X:85417160-85417182 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193815887 X:86104091-86104113 AAGAGCTATCGGCCTTAATGAGG + Intergenic
1193899478 X:87160023-87160045 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1193980738 X:88179334-88179356 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1194083423 X:89497397-89497419 AAGAGTTATTGGCCTTAAAGTGG - Intergenic
1194096033 X:89639620-89639642 AAGAATTATTGGCCTTAAAGTGG + Intergenic
1194165220 X:90507248-90507270 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194228188 X:91287778-91287800 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194253346 X:91604616-91604638 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194274648 X:91864618-91864640 AAGAGTGACTGGCCTTAAAGAGG - Intronic
1194290880 X:92070779-92070801 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1194322994 X:92475794-92475816 AAGAGTAACTGGCCTTAAAGAGG - Intronic
1194329352 X:92561683-92561705 AAGAGTTATTGGCCTTAAAGGGG + Intronic
1194398608 X:93415870-93415892 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194447023 X:94001077-94001099 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1194493462 X:94579530-94579552 AAGAGTTATTGGACTTAAAGAGG + Intergenic
1194558773 X:95395074-95395096 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1194561710 X:95429502-95429524 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194568633 X:95524256-95524278 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1194787453 X:98104891-98104913 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1194823591 X:98533713-98533735 GAGAGTTATTGGCCTTAATTAGG + Intergenic
1194877385 X:99206962-99206984 AAGAGTTAATGGTCTTAAAGAGG - Intergenic
1194882925 X:99275647-99275669 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1194889979 X:99366100-99366122 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194892126 X:99393499-99393521 AAGAGTTATTGGCCTTGAAGAGG - Intergenic
1194921817 X:99776913-99776935 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1194990933 X:100545685-100545707 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1195122774 X:101773655-101773677 CAGAGTTAGTGGCCTTAAAGAGG - Intergenic
1195199518 X:102534190-102534212 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1195312453 X:103644757-103644779 AAGAGTTAGTGGCCTTAAAGAGG + Intergenic
1195489231 X:105448350-105448372 AAAAGTTATTGGCCTTAAAGAGG - Intronic
1195506230 X:105659908-105659930 AAGACTTATTGGCCCTAAAGAGG + Intronic
1195542901 X:106083591-106083613 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
1195601455 X:106753091-106753113 AAGAGTTATTTGCCTTAAAGAGG + Intronic
1195828717 X:109032353-109032375 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
1195848978 X:109262922-109262944 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1195851914 X:109293129-109293151 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1196163250 X:112509662-112509684 AAGAGTTACTGGCCTTACTGAGG - Intergenic
1196233328 X:113251436-113251458 ATGAGTTATTGGCCTTAAAGAGG - Intergenic
1196248601 X:113430156-113430178 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1196399373 X:115298407-115298429 AAGAGTTATTGGCTGTAAAGAGG - Intronic
1196461212 X:115934010-115934032 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1196466350 X:115974899-115974921 AAGAGTTATTGGCTTTAAGGAGG + Intergenic
1196485458 X:116202168-116202190 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1196486914 X:116222471-116222493 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1196494205 X:116305587-116305609 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1196576436 X:117324361-117324383 AAGAGTTATTGGCCTTAAACCGG - Intergenic
1196609733 X:117697263-117697285 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
1196613934 X:117745266-117745288 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1196922287 X:120596284-120596306 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1196961951 X:121013196-121013218 AAGAGTTATTGGACATAAAGAGG - Intergenic
1196984382 X:121252429-121252451 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1197025168 X:121739358-121739380 AAGAGGTATTGGCCTTAAAGAGG + Intergenic
1197099409 X:122635227-122635249 AACAGTTACTGGCCTTAAAGAGG - Intergenic
1197117271 X:122848571-122848593 AAGAGTGAGGGGCCCTATTTAGG - Intergenic
1197307827 X:124864636-124864658 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1197360940 X:125503351-125503373 AAAAGTTATTGGCCATAAAGAGG - Intergenic
1197382608 X:125764232-125764254 AAGATGTAGTGGCCTTAAAGAGG - Intergenic
1197403140 X:126018147-126018169 AAGAGTTACTGACCTTAAAGAGG - Intergenic
1197429591 X:126343918-126343940 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1197440188 X:126477754-126477776 AAGAGTTATTGGCCTTTAAGAGG + Intergenic
1197481919 X:126996712-126996734 AAGAGTTATTGGTCCTAAAAAGG + Intergenic
1197514516 X:127409652-127409674 AAGAGTTACTGGCCTTAAACAGG - Intergenic
1197581537 X:128289682-128289704 AAGAGTTACTGGCCATAAAGAGG + Intergenic
1197661361 X:129177538-129177560 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1197677819 X:129348829-129348851 AAGAGTTATTGGCCTTCAGGAGG + Intergenic
1197876377 X:131113284-131113306 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1198293890 X:135265233-135265255 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1198414244 X:136403692-136403714 AAGAGTTAGTGGCCCCTACAAGG + Intronic
1198430631 X:136563313-136563335 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1198581606 X:138071582-138071604 AAAAGGTAGTGGCCCTAAGTGGG + Intergenic
1198664565 X:139005960-139005982 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1198702401 X:139412399-139412421 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1198788350 X:140315198-140315220 AGGTGTTATTGGCCTTAATGAGG + Intergenic
1198855973 X:141017051-141017073 AAGAGTTATTGGCCTTAAGGAGG - Intergenic
1198876159 X:141229060-141229082 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
1198906719 X:141570316-141570338 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
1198917014 X:141683988-141684010 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1198925438 X:141786918-141786940 AAGAGTTATTGGCCTAAAAGAGG - Intergenic
1198996058 X:142575870-142575892 AAAAGTTACTGGCCCTAATAAGG - Intergenic
1199076058 X:143528371-143528393 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1199145724 X:144363920-144363942 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
1199148459 X:144398887-144398909 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1199173750 X:144760212-144760234 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1199176075 X:144788495-144788517 AAGAATTATTGGCCATAAAGAGG + Intergenic
1199196390 X:145036235-145036257 ATGAGTTATTGGCCTTAAGGAGG - Intergenic
1199239310 X:145527776-145527798 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1199274794 X:145927962-145927984 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1199316227 X:146380883-146380905 AAGAGTAACTGGCCTTAAAGAGG + Intergenic
1199334172 X:146599562-146599584 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1199358471 X:146888140-146888162 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1199415248 X:147574495-147574517 AAGAATTACTGGCCTTAAAGGGG + Intergenic
1199442888 X:147888682-147888704 AAGGGTTATTGGCCTTAAAGAGG - Intergenic
1199454873 X:148017480-148017502 AAGAGTTAGTGGCCTTAAAAAGG - Intronic
1199568592 X:149245059-149245081 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1199908934 X:152263608-152263630 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1200332053 X:155308441-155308463 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1200436075 Y:3153276-3153298 AAGAGTTATTGGCCTTAAAGTGG - Intergenic
1200449036 Y:3300999-3301021 AAGAATTATTGGCCTTAAAGTGG + Intergenic
1200511483 Y:4085058-4085080 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1200591890 Y:5086021-5086043 AAGAGTGACTGGCCTTAAAGAGG - Intronic
1200608392 Y:5295356-5295378 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1200631094 Y:5588954-5588976 AAGAGTAACTGGCCTTAAAGAGG - Intronic
1200638052 Y:5680873-5680895 AAGAGTTATTGGCCTTAAAGGGG + Intronic
1201067130 Y:10107846-10107868 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1201372456 Y:13280083-13280105 AAGAGTTATTGGCATTAAAGAGG + Intronic
1201760736 Y:17535491-17535513 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1201840816 Y:18370499-18370521 AAGAGTTATTGGCCTTAAAGAGG + Intergenic