ID: 1190912621

View in Genome Browser
Species Human (GRCh38)
Location X:54786879-54786901
Sequence GGTGCCCAGTGAGCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 2, 2: 3, 3: 30, 4: 278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190912617_1190912621 12 Left 1190912617 X:54786844-54786866 CCAACGTTGGCCAACTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278
1190912614_1190912621 20 Left 1190912614 X:54786836-54786858 CCGGGTTCCCAACGTTGGCCAAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278
1190912611_1190912621 25 Left 1190912611 X:54786831-54786853 CCCTTCCGGGTTCCCAACGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278
1190912618_1190912621 2 Left 1190912618 X:54786854-54786876 CCAACTCAAGGTATGACACAGAT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278
1190912616_1190912621 13 Left 1190912616 X:54786843-54786865 CCCAACGTTGGCCAACTCAAGGT 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278
1190912613_1190912621 24 Left 1190912613 X:54786832-54786854 CCTTCCGGGTTCCCAACGTTGGC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG 0: 1
1: 2
2: 3
3: 30
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190912621 Original CRISPR GGTGCCCAGTGAGCCCCAGC GGG Intronic
900207408 1:1437501-1437523 AGGGCCCAGGGAGCCCTAGCTGG + Intronic
900285133 1:1895444-1895466 GGCACCCAGTGGGCCTCAGCAGG - Intergenic
900525186 1:3125010-3125032 AGAGCCCAGAGAGCCCCAGGGGG - Intronic
900684850 1:3941650-3941672 GGTGCCCTGTGAGCTTCAGAGGG - Intergenic
901405123 1:9040157-9040179 GGACCCCGGTCAGCCCCAGCAGG + Exonic
901691460 1:10976062-10976084 GTTGCCCAGTGTCACCCAGCAGG + Intronic
902581284 1:17409397-17409419 GCTGCCCTGGGAGACCCAGCTGG + Intronic
902656061 1:17869127-17869149 TGTGTCCAGGGAGCCCAAGCTGG - Intergenic
902659551 1:17891681-17891703 GGTGTCCAGCGTGCACCAGCAGG + Intergenic
903179441 1:21597916-21597938 GGTGCTGAGGGAGCCCCACCCGG - Intronic
903942775 1:26942945-26942967 GCTGCCCCTTGAGCCCCACCCGG - Exonic
904439645 1:30521975-30521997 GGTTAACAGGGAGCCCCAGCAGG + Intergenic
905631403 1:39521132-39521154 GGTGCTCAGTGAGCTGCAGGCGG - Intronic
905648350 1:39639912-39639934 GGTGCCCTGGGAGGCCCCGCGGG + Exonic
905666351 1:39765039-39765061 GGTGCTCAGTGAGCTGCAGGCGG + Intronic
906531060 1:46524300-46524322 TCTGCCCAGGGAGCCCCATCTGG - Intergenic
909075603 1:71047603-71047625 GGCGTCCAGAGAGCCGCAGCGGG + Exonic
909480428 1:76124176-76124198 AGTGCCAGGTGAGCCCCAGCTGG + Intronic
912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG + Intergenic
913259176 1:116982933-116982955 GGTGGCCAGTCCACCCCAGCTGG - Intronic
915354868 1:155250199-155250221 GGTGGCCAGTGATGCCCACCAGG - Intronic
915931483 1:160063137-160063159 CCTGCCCAGGGAACCCCAGCAGG + Intronic
916729496 1:167553523-167553545 GGTGGCCAGAGCGCCCCAGTCGG + Exonic
917970341 1:180201989-180202011 GGTGGCCAGAGAGACTCAGCCGG - Exonic
919966144 1:202527390-202527412 GCTGCACACTGAGCCCCATCAGG + Intronic
920505633 1:206513454-206513476 GGGGCTCAGTCAGCACCAGCTGG + Intronic
922257032 1:223901171-223901193 GCTGCCCATTGAGGCCCAGAGGG - Intergenic
922575156 1:226656238-226656260 GGCGCTCAGAGACCCCCAGCAGG + Intronic
924338224 1:243003978-243004000 GCTGCCCATTGAGGCCCAGAGGG - Intergenic
924612878 1:245588482-245588504 GGGGCCCAGTGAAGCCCAGCTGG - Intronic
1063121169 10:3106487-3106509 GGCCCCCAGTCAGCCCCAGGTGG - Intronic
1063447722 10:6130146-6130168 GCTGCCCAGTCATCCCCAACTGG - Intergenic
1063761602 10:9084750-9084772 GGTTCCCACTGAGCTCCACCTGG + Intergenic
1065871721 10:29961423-29961445 AGTGCACAGTGGACCCCAGCTGG + Intergenic
1066264882 10:33766922-33766944 GGTGCCCAGTGACAACCACCGGG - Intergenic
1067235076 10:44440056-44440078 GATGAGCAGGGAGCCCCAGCTGG - Intergenic
1068956943 10:62826976-62826998 GAAGCCAAGTGAGCCCCAGAGGG + Intronic
1069307032 10:66983410-66983432 GGTGCCCAGGCATCCCCAGATGG + Intronic
1069445703 10:68471659-68471681 GGTGCCCAGGGAGCTGCACCGGG + Intronic
1069827434 10:71262759-71262781 TGTGCCAAGTGAGGCCCAGGGGG - Intronic
1069948136 10:72001378-72001400 GGCCCCCAGTGGGCCCAAGCAGG + Intronic
1070590051 10:77794970-77794992 GGTGCAGAGTGAGCCCTGGCGGG + Intronic
1073484515 10:103808187-103808209 GGTGTGCAGTGGGCCACAGCAGG - Intronic
1074639781 10:115367784-115367806 GGTGTCAAGTGTGCCCCTGCTGG + Intronic
1075655037 10:124155828-124155850 GGTGTCCAGAGACCCCCACCAGG + Intergenic
1076695728 10:132246432-132246454 CTTGCCCAGTGAGTGCCAGCAGG - Intronic
1076914985 10:133418942-133418964 GGTGCCTAGTCAGCCCATGCTGG + Intronic
1077138783 11:1014439-1014461 GGAGCTCCGTGTGCCCCAGCTGG + Intronic
1077235488 11:1480177-1480199 GGTCCCCAGTGGGGCCCAGAAGG - Intronic
1079098453 11:17526295-17526317 CGTGGCCAGTGCACCCCAGCAGG - Intronic
1079532513 11:21472196-21472218 GCTGAACAGTGAGCCACAGCTGG - Intronic
1081488263 11:43547907-43547929 GGAGCCCAGGGAGCCCGAGCTGG - Intergenic
1082930071 11:58593278-58593300 GATGCTCAGAGAGCACCAGCAGG + Intronic
1083727803 11:64637434-64637456 GGAGCCCAGTAGGCCTCAGCCGG + Intronic
1083853926 11:65382845-65382867 GGTGACATTTGAGCCCCAGCTGG - Intronic
1084274576 11:68044844-68044866 GCTGCCCAGTGAGCCCCCACAGG + Intronic
1084432957 11:69121779-69121801 GGTGCCCAGTGAGGGGCAGGGGG + Intergenic
1084460960 11:69296290-69296312 GGTGCATAGTGGGCCCCACCTGG - Exonic
1084666097 11:70577152-70577174 GGAGCCCAGACAGCCCCAGGAGG + Intronic
1085461304 11:76695526-76695548 TGTACCCAGTGAGCTCCAGCAGG + Intergenic
1085517974 11:77122394-77122416 GATGGCCAGTGTGCCCCTGCTGG + Intronic
1090423320 11:126590532-126590554 TGTCCACAGTGAGCCACAGCAGG - Intronic
1090456112 11:126851027-126851049 AGTGCCTAGTGAGACCCAGGTGG - Intronic
1091552874 12:1550167-1550189 GGGGCCCTTTGAGCCACAGCTGG - Intronic
1092281690 12:7102201-7102223 GGTGCCTTCTGAGCCCCAGAGGG - Intronic
1094063074 12:26335080-26335102 TGTGCCCACTGAGCTCAAGCAGG + Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1098790486 12:74816550-74816572 GGGGCCCAGGAAGCCCCTGCAGG + Intergenic
1100855325 12:98752650-98752672 GATCCCCAGTTAGCCCCAGGAGG + Intronic
1102221178 12:111195449-111195471 GGTGCCCAGTGATGCCCCGCTGG - Intronic
1102245525 12:111353363-111353385 GTTGCCCAATGGCCCCCAGCTGG - Intergenic
1102504446 12:113374793-113374815 GGTCCCCAGAGAGCTGCAGCAGG - Exonic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103593797 12:122010766-122010788 GGAGCCAAGTGAGCCAAAGCTGG + Intergenic
1103949710 12:124544091-124544113 CCTGCCCGGGGAGCCCCAGCGGG + Intronic
1104049661 12:125186835-125186857 GGAGCGCAGTCAGCGCCAGCAGG - Intronic
1104444634 12:128823473-128823495 GGTGGCCGGTGAGCAGCAGCGGG + Exonic
1104568319 12:129903985-129904007 AGAGCCCCGCGAGCCCCAGCCGG - Intergenic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1105606847 13:21933100-21933122 GGTGCTCAGTGAAACCCAGATGG + Intergenic
1106022293 13:25926941-25926963 GGTGCCCAGAGAGCCCTGGGAGG + Intronic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113582158 13:111437488-111437510 GGTGCCCTGGGAGCTCCATCTGG - Intergenic
1113591839 13:111506875-111506897 AGTGCCCAGTGGGCCCCTGAGGG + Intergenic
1113785502 13:113000220-113000242 GCTGCCCCCTGAGCCACAGCAGG - Intronic
1114951610 14:27761579-27761601 GCTGCACTGTGAGCCCAAGCTGG + Intergenic
1115200546 14:30849565-30849587 GGTGCCCAGCAGGCTCCAGCTGG + Intergenic
1115507900 14:34110287-34110309 GGTGCCCATAGAGTGCCAGCAGG - Intronic
1117209577 14:53481573-53481595 GGGGCCCTTTGAGCCACAGCTGG + Intergenic
1118288714 14:64501873-64501895 GTTGCCCAGAGAGGCCAAGCAGG - Intronic
1118714290 14:68548268-68548290 GGGGGCAAGTGAGCCACAGCGGG - Intronic
1118772066 14:68948857-68948879 GGTGCCCCGTGCGCCTCAGGAGG - Intronic
1119018724 14:71086732-71086754 TCTGCCCTGTGAGCTCCAGCTGG + Intronic
1119656482 14:76420965-76420987 GGTGCTCAGTGAGACACTGCAGG - Intronic
1121305844 14:92906543-92906565 GGTGGTCACTGAGACCCAGCTGG + Intergenic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1121709433 14:96026708-96026730 AGTACCCACTGAGCCCCAGCAGG + Intergenic
1121996355 14:98606483-98606505 GATGGCCAGTAAGACCCAGCAGG - Intergenic
1122037836 14:98961382-98961404 GGTTTCCAGTGAGCACCAGGTGG + Intergenic
1122906279 14:104803018-104803040 GGGGCACAGTGAGTGCCAGCAGG + Exonic
1124604347 15:31159925-31159947 GGTGCTCAGTAAGTGCCAGCTGG + Intronic
1128603000 15:69013681-69013703 GGCTTCCAGTGAGCCCCTGCTGG + Intronic
1128880733 15:71240245-71240267 AGTGCTGAGTGAGCTCCAGCAGG + Intronic
1129152100 15:73695836-73695858 GTTGCCCAAGGAGCCCCTGCGGG + Intronic
1129153285 15:73702586-73702608 GGTGGCCGGTGAGCACCAGGAGG + Exonic
1129153599 15:73703990-73704012 GGTGGCCGGTGAGCACCAGGAGG + Exonic
1129664613 15:77572576-77572598 AGAGCCCAGTGAGCCACATCTGG - Intergenic
1130650222 15:85758217-85758239 GGAGCCCTGTGGGCCACAGCTGG + Intergenic
1132111082 15:99102874-99102896 AGGGACCAGTGAGTCCCAGCAGG - Intronic
1140411101 16:74740849-74740871 GTGGCCCTGTGAGCCCCACCAGG - Intronic
1141196896 16:81866956-81866978 TGTGCCCAGCCAGCCCCAGCTGG + Intronic
1141480065 16:84300440-84300462 GGATCCCAGGAAGCCCCAGCTGG - Intronic
1141636353 16:85315975-85315997 GGTGCCCATGGTGCCCCTGCTGG + Intergenic
1142707871 17:1708049-1708071 GGTGGCCAAGGAGGCCCAGCTGG + Exonic
1142919915 17:3176000-3176022 AATGTCCAGTGAGCCCCAACTGG + Intergenic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1145059167 17:19721377-19721399 GGTGCCCAGGGAGACCTTGCGGG - Intergenic
1145258784 17:21342537-21342559 GGTTCCCAGAGAGGCCCAGGAGG - Intergenic
1145302355 17:21649554-21649576 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1145317840 17:21745467-21745489 GGTTCCCAGAGAGGCCCAGGAGG + Intergenic
1145347963 17:22053758-22053780 GGTGCCCTGCCAGCCACAGCAGG + Intergenic
1145415621 17:22711624-22711646 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1145911942 17:28548114-28548136 GAAGCCCACTGAGCCCCAGCTGG - Intronic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1146461900 17:33052683-33052705 CGTGCCCACTGAGCTCTAGCGGG + Intronic
1147686203 17:42288264-42288286 GGTCCCCCGGGAGTCCCAGCAGG - Exonic
1150893261 17:69179409-69179431 TGTGGCCAGTGGGCCCCAGAGGG - Intronic
1151878258 17:76879527-76879549 GCTGCCCAGTGAGGCCACGCAGG + Intronic
1151948027 17:77330016-77330038 TGAGCACAGGGAGCCCCAGCTGG - Intronic
1152073649 17:78146230-78146252 GGGGCCCAGAGAGCCCCGGCAGG - Intergenic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152573390 17:81130157-81130179 GGTGCCAACAGAGCCCCAACAGG + Intronic
1153223844 18:2883155-2883177 GGTGCCTAGCCAGTCCCAGCGGG + Intronic
1154008803 18:10558577-10558599 GGTGGCCAGTGAGTCCCTGTGGG - Intergenic
1157476780 18:48028889-48028911 GGTGCCCAGCCAGCCACAGCAGG - Exonic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1161475024 19:4479934-4479956 GATGCCCAGAGGGACCCAGCTGG + Intronic
1161569661 19:5023582-5023604 CGGCCCCAGTGAGTCCCAGCCGG - Intronic
1162026118 19:7895081-7895103 GGTGCCCAGAGTGCCCCTGGAGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1163120437 19:15214050-15214072 GGAGCCTAGTGAGAACCAGCAGG + Intergenic
1163427717 19:17248172-17248194 GGTTCCCAGGCTGCCCCAGCAGG - Intronic
1163783895 19:19264606-19264628 CGTGCCCAGTCAGCCCTACCTGG - Exonic
1164591595 19:29510647-29510669 CCTGCCCAGGGAGCCACAGCTGG + Intergenic
1165324226 19:35104806-35104828 GGTGCCCAGCAAGCCACAGAAGG - Intergenic
1165777808 19:38415099-38415121 GGAGCTCAGTGAGCTCCAGGAGG + Exonic
1165839409 19:38778931-38778953 AGTGCCCAGTGAGGGCCAGCAGG + Intergenic
1166144605 19:40825337-40825359 GGGGCCCATTCAGTCCCAGCTGG + Intronic
1166677280 19:44747859-44747881 GGTGCCCCGCGGGCCCCGGCTGG + Intronic
1166939646 19:46355090-46355112 CCTGCCCAGTGACCCCCACCTGG + Intronic
925058870 2:875920-875942 GGTGACGGGGGAGCCCCAGCAGG + Intergenic
925864943 2:8219439-8219461 GGTGCTCAGTGGGCCCCAAGGGG + Intergenic
926155656 2:10452535-10452557 GCTTCCCAGTGAGCCACACCAGG - Intergenic
926796649 2:16625219-16625241 GGGGGCCTGGGAGCCCCAGCTGG - Intronic
927104356 2:19810885-19810907 GGAGCCCAGCTGGCCCCAGCTGG + Intergenic
928225453 2:29444367-29444389 GATGCCCAGTGAGCACCCACGGG - Intronic
933648708 2:84831991-84832013 GGTGCCCAGGCAGCCCCATGAGG + Intronic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
935545404 2:104395320-104395342 GGTGACCATCAAGCCCCAGCTGG - Intergenic
936798850 2:116242042-116242064 GGTTCCCAGTGATCCCTACCTGG + Intergenic
937474952 2:122207062-122207084 GGTGCTGCGTGAACCCCAGCAGG + Intergenic
938292980 2:130160143-130160165 GGTGACCAGCGAGACCCAGGTGG - Intronic
938463574 2:131512821-131512843 GGTGACCAGCGAGACCCAGGTGG + Intergenic
940322335 2:152390260-152390282 GCTGCCCCTTGAGCCCCACCCGG - Intronic
942188678 2:173449192-173449214 AGTTCTCAGAGAGCCCCAGCCGG - Intergenic
942678772 2:178455053-178455075 GCTGCCCCTTGAGCCCCACCTGG - Intronic
943646124 2:190408837-190408859 GCTGCCCAGGGAGCCCTCGCCGG + Intronic
946110732 2:217413019-217413041 GTTCCTCAGTTAGCCCCAGCTGG - Intronic
946154973 2:217801322-217801344 GGGGCCCAGTGAGCTCCACGTGG - Exonic
947872472 2:233447091-233447113 GCTGCGCAGTGAGCCCCAAACGG + Intronic
948299294 2:236890035-236890057 GGGGAGCAGTGGGCCCCAGCTGG + Intergenic
1170034628 20:11977118-11977140 GCTGCCCAGGCAACCCCAGCTGG + Intergenic
1170722887 20:18899983-18900005 GTTTCCCAGAGAGTCCCAGCAGG + Intergenic
1171518936 20:25760981-25761003 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1172025149 20:31943355-31943377 GGTGCCCAGTGACTCCAAGTAGG - Exonic
1172157559 20:32839229-32839251 GGTGCCCACTGCTCCCCATCTGG - Intronic
1172245787 20:33443980-33444002 GGAACCCAGTGAGCCCGCGCAGG + Intergenic
1173314538 20:41931434-41931456 GGTACCCTTTGAGCCACAGCTGG + Intergenic
1173795173 20:45854947-45854969 GGTACCCAGTGAGTCCCAGCAGG + Intronic
1176205481 20:63885890-63885912 CGTGCTCAGTCAGGCCCAGCAGG - Intronic
1176233152 20:64042131-64042153 GGTTCCGAGTCAGCCACAGCTGG - Intronic
1176253751 20:64139820-64139842 GGTGACCAGTGTGTCCCAGTTGG - Intergenic
1176653084 21:9567389-9567411 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1179121515 21:38550269-38550291 GGTGGCCACTGAGACCAAGCAGG + Intronic
1179309062 21:40180877-40180899 GGTGCCCAGTGACCACCAAGAGG - Intronic
1179618697 21:42598499-42598521 GGTGTCCAGTGGTCCTCAGCGGG - Intergenic
1180831101 22:18906530-18906552 GGAGCGCGGTGAGCCCCGGCGGG - Intronic
1181068741 22:20319811-20319833 GGGGCGCGGTGAGCCCCGGCGGG + Intronic
1181526716 22:23493715-23493737 AGTGCACACTGAGTCCCAGCAGG + Intergenic
1184228335 22:43143433-43143455 GGTGCCCCGGAAGCCCCGGCAGG - Intergenic
1184402403 22:44281641-44281663 AGAGCCCAGTGTGACCCAGCAGG - Intronic
1184656705 22:45945636-45945658 CAGGCCCAGTGACCCCCAGCAGG - Intronic
1185205451 22:49535630-49535652 GGTGGCCAGGGAGCCCCAGGAGG + Intronic
1185233151 22:49694753-49694775 GGTGCTCAGGGAGCTCCAGGGGG + Intergenic
1203281188 22_KI270734v1_random:131801-131823 GGAGCGCGGTGAGCCCCGGCGGG - Intergenic
949928040 3:9057575-9057597 GGGTCCCAGTGAGGCTCAGCTGG - Intronic
952924767 3:38312939-38312961 GATGCCCAGAGACCCCCTGCTGG - Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953223822 3:40998580-40998602 GGTTCCCAGAGGGCCCCAGCGGG + Intergenic
954127734 3:48541596-48541618 AGTGTCCAGTGAGCCCTGGCTGG - Intronic
954223465 3:49168206-49168228 GGTGCCCAGTATGCCCTAGATGG + Intergenic
954325992 3:49864346-49864368 GGTCCCCTGTGGGCCCCAGTGGG - Intronic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
954570534 3:51637279-51637301 GGTACCCAGTCAGCACCACCCGG - Exonic
954706406 3:52483102-52483124 GGTGCCCAGCGTGGCCCATCAGG + Intronic
960557333 3:119043764-119043786 GGAGCCCAGTTAGCCCCACTGGG + Intronic
960942314 3:122943060-122943082 GGTGCCCAGGGGCCCCCTGCCGG - Intronic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
961112720 3:124298677-124298699 GGTTCTCACTGAGCACCAGCAGG + Intronic
962256073 3:133871126-133871148 GGCACACAGTGAGCCCCAGTGGG - Intronic
964427781 3:156571342-156571364 GGAGCCCAGTTAGCTACAGCTGG + Intergenic
965342036 3:167503095-167503117 GGGGCCCTTTGAGCCACAGCTGG - Intronic
965782134 3:172296995-172297017 CGTGCCCAGAGAGGCTCAGCAGG + Intronic
967524981 3:190481971-190481993 TCTGCTCAGGGAGCCCCAGCTGG - Intergenic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968735356 4:2292262-2292284 GGGACTCAGTGAGACCCAGCTGG + Intronic
968967701 4:3777386-3777408 GGGGCCCAGTGAGACCAAGCAGG - Intergenic
969032716 4:4227147-4227169 GTTGCCCAGTGAGGGGCAGCGGG - Intergenic
969694775 4:8728382-8728404 GGTGGCCACTCAGCCCCGGCAGG - Intergenic
973665348 4:53153412-53153434 GGGGCCCTTTGAGCCACAGCTGG + Intronic
975591223 4:76001936-76001958 GGTGCCCAGTTAGCCTCTGCAGG - Exonic
976155914 4:82144699-82144721 GGCTCCCAGAGATCCCCAGCAGG + Intergenic
979238894 4:118431301-118431323 GCTGCCCATTGAGGCCCAGAGGG + Intergenic
985527390 5:413856-413878 GCTGCCCAGCCAGCCCCAGGTGG + Intronic
985666275 5:1183023-1183045 GGTGCCCAGGGAGTCCACGCTGG + Intergenic
985824454 5:2182037-2182059 GGTGCCCACTGGGGCCCAGTTGG + Intergenic
991544385 5:67765294-67765316 GGCCTCCAGTGAGCCCCAGATGG - Intergenic
995824543 5:116280345-116280367 GGTGCCCTTTGAGCCAGAGCTGG + Intronic
997614593 5:135237666-135237688 GGGGACCAGAGAGACCCAGCTGG - Intronic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
999995671 5:157090017-157090039 GGTACCCAGTAAGCCACACCTGG - Intronic
1000830311 5:166093918-166093940 GGGTCCCTTTGAGCCCCAGCTGG + Intergenic
1002100316 5:176854476-176854498 GGAGCCCAGTGTGGCTCAGCCGG - Intronic
1002599019 5:180343417-180343439 GGTGCCCACTCAGGCACAGCAGG + Intronic
1005963135 6:30707576-30707598 GATCCCCAGTGAGCCCCAGGAGG - Exonic
1006364024 6:33604283-33604305 GGTGCCCTTTGAGCCACAGCTGG + Intergenic
1006615171 6:35321271-35321293 GTTGCCCTGGGATCCCCAGCGGG - Exonic
1006785267 6:36662441-36662463 GGTGCTCAGTGAGGCACACCTGG - Intergenic
1007112985 6:39324173-39324195 GCACCCCAGTGAGTCCCAGCAGG + Intergenic
1007165550 6:39826302-39826324 GGAGCCCAGAGAGTTCCAGCAGG - Intronic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007582020 6:42965477-42965499 TGTGCCCAATGTGCCCCACCAGG + Intronic
1010896116 6:81366306-81366328 AGTGCACAGTGCGCCGCAGCAGG - Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1018903850 6:168064058-168064080 CCTGCCCAGTGAGGACCAGCTGG + Intronic
1018913337 6:168116992-168117014 GGTGCCCAGAGATGCACAGCGGG + Intergenic
1019151337 6:170007943-170007965 GGTGACCAGAGAAGCCCAGCTGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019524422 7:1474375-1474397 AGGGCCCAGTCAGCCCCGGCCGG + Intronic
1019747655 7:2709562-2709584 GATCCCCAGGCAGCCCCAGCAGG - Intronic
1020682138 7:11250409-11250431 GGTGCTCTGTCAGCCCCAGCTGG + Intergenic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1022838440 7:34138784-34138806 GCTGCCCAGTGTGCTCCAGTGGG - Intronic
1022904633 7:34843890-34843912 TGTGCCCATTGAGCCCCACTGGG + Intronic
1023888595 7:44377260-44377282 GGTGCCCACTCAGCCCTGGCTGG + Intergenic
1023899895 7:44467575-44467597 GGTCCCCATTGAGGCCCGGCAGG + Intronic
1024197250 7:47071354-47071376 GGAGCCCAGTGGAGCCCAGCAGG + Intergenic
1024509334 7:50190810-50190832 GGTGCCCAATGAGCAGCAGCAGG + Intergenic
1025279429 7:57616110-57616132 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1025305302 7:57849390-57849412 GGTGCCCTGCCAGCCACAGCAGG + Intergenic
1029113023 7:98223136-98223158 GGTGACCAGTGGGCCCTGGCTGG - Exonic
1029706319 7:102278158-102278180 GGGGCCCAGTGCTGCCCAGCAGG - Intronic
1032076743 7:128839686-128839708 GGTGCCCTGAGAGGCCCAGAGGG + Intronic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1033241035 7:139680321-139680343 GGTGCCCAAGCAGCCCCAGTAGG + Intronic
1033589001 7:142795433-142795455 TGGGCACAGTGAGCCCCACCAGG + Intergenic
1034298297 7:149993330-149993352 GGTGCCCTGCGAGGCCAAGCAGG + Intergenic
1034469969 7:151249774-151249796 GGTGGCAAGGGAGCCCCAGAAGG + Intronic
1035295351 7:157864283-157864305 GGTGCCCAGTGAACCTCGGGTGG - Intronic
1035976311 8:4315336-4315358 GCTGCACTGTGAGCCCCAGGTGG + Intronic
1036057012 8:5266707-5266729 AGTGTCCAGTGATCCACAGCAGG - Intergenic
1036828414 8:11999108-11999130 GGTCTCAAGTGAGCCCCAGCTGG + Intergenic
1040134167 8:43833226-43833248 GGGGCCCAGTGAGACCCATAGGG + Intergenic
1040136073 8:43855467-43855489 GGTGCCCATTGAGACCCATGTGG + Intergenic
1040576044 8:48652363-48652385 GGTGCTCAGTGGGCACCACCAGG + Intergenic
1041794613 8:61733732-61733754 GGTGGCCAGAGAGCCACGGCTGG - Intergenic
1042605441 8:70541444-70541466 GGAGCCCTGTTAGCCACAGCTGG - Intergenic
1043384246 8:79732392-79732414 GGGCCCCTTTGAGCCCCAGCTGG + Intergenic
1044733139 8:95248877-95248899 GGTGCCCATTGACCACCAGAGGG - Intronic
1045880322 8:107030548-107030570 GATGCCCTATGAGCCACAGCTGG - Intergenic
1046314262 8:112479149-112479171 GTGGCCCAGTGAGGCCCAGGTGG + Intronic
1049584452 8:143426415-143426437 GGGGCTCCGTGAGCCCCCGCGGG - Intronic
1049654246 8:143790796-143790818 CGTGCGCAGTGAGGCGCAGCGGG + Intergenic
1051367328 9:16330174-16330196 GGTGCCCAGTGAGGGTCAGAGGG - Intergenic
1053066367 9:35072151-35072173 GGTGCGCAGCTGGCCCCAGCCGG + Intronic
1056021262 9:82440696-82440718 GGGGCCCTTTGAGCCACAGCTGG - Intergenic
1056216278 9:84408638-84408660 GGTGCGCAGGGTCCCCCAGCAGG + Intergenic
1057551491 9:96054011-96054033 GGGGCCGGGGGAGCCCCAGCAGG - Intergenic
1058404588 9:104657656-104657678 GGTAGCCAGAAAGCCCCAGCAGG + Intergenic
1061151264 9:128829585-128829607 GGTGCCGCGTGAGCCTCAGCAGG - Intronic
1061511939 9:131067000-131067022 GGTGCCCAAAGAGCCCCAGCGGG - Exonic
1061673250 9:132201172-132201194 GGTGCCCCTTCAACCCCAGCAGG + Intronic
1061780981 9:132995946-132995968 GGTGCCCAGTGAGCCCGCCATGG + Intergenic
1061995390 9:134180473-134180495 GGTGCCCAGAGACCTCCAGAGGG - Intergenic
1062398961 9:136364153-136364175 GGTGCCCTGAAAGGCCCAGCCGG - Exonic
1062656413 9:137606241-137606263 GGGGCGCAGGGAGCCGCAGCAGG - Intronic
1062690264 9:137837914-137837936 GGAGCCCAGGGGGCCCCAGCCGG + Intronic
1203630815 Un_KI270750v1:70929-70951 GGTGCCCTGCCAGCCACAGCAGG - Intergenic
1186998310 X:15148321-15148343 GGTGCCTAGTGAGACCCTCCAGG - Intergenic
1187468113 X:19543849-19543871 GGTGCCCAGTAGGCCCCTGGGGG + Intronic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1190322429 X:49186839-49186861 GGTTCCCAGCGAGCACCAGCTGG - Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1191875208 X:65788500-65788522 GGGGCAGAGGGAGCCCCAGCCGG - Intergenic
1193740810 X:85215174-85215196 GGGGCCCTTTGAGCCACAGCTGG + Intergenic
1194360351 X:92942178-92942200 GGAGCCCTTTGAGCCACAGCTGG + Intergenic
1197729066 X:129794915-129794937 GGTGTACATTGAGCCCCAGAAGG + Exonic
1200668554 Y:6057996-6058018 GGAGCCCTTTGAGCCACAGCTGG + Intergenic
1202386654 Y:24333109-24333131 GCTGCCCATTGAGGCCCAGAGGG + Intergenic
1202484131 Y:25337019-25337041 GCTGCCCATTGAGGCCCAGAGGG - Intergenic