ID: 1190912849

View in Genome Browser
Species Human (GRCh38)
Location X:54788447-54788469
Sequence CTGGGGAAGAGGAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2403
Summary {0: 2, 1: 0, 2: 26, 3: 258, 4: 2117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190912849 Original CRISPR CTGGGGAAGAGGAGAGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr