ID: 1190912862 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:54788500-54788522 |
| Sequence | TCAGTACGATGTGGTCATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 101 | |||
| Summary | {0: 2, 1: 0, 2: 0, 3: 5, 4: 94} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190912862_1190912868 | 14 | Left | 1190912862 | X:54788500-54788522 | CCTCCATGACCACATCGTACTGA | 0: 2 1: 0 2: 0 3: 5 4: 94 |
||
| Right | 1190912868 | X:54788537-54788559 | CATGATGCCTGACCCAGAGATGG | 0: 1 1: 0 2: 5 3: 34 4: 348 |
||||
| 1190912862_1190912870 | 22 | Left | 1190912862 | X:54788500-54788522 | CCTCCATGACCACATCGTACTGA | 0: 2 1: 0 2: 0 3: 5 4: 94 |
||
| Right | 1190912870 | X:54788545-54788567 | CTGACCCAGAGATGGACGACTGG | 0: 1 1: 0 2: 0 3: 5 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190912862 | Original CRISPR | TCAGTACGATGTGGTCATGG AGG (reversed) | Exonic | ||