ID: 1190912862

View in Genome Browser
Species Human (GRCh38)
Location X:54788500-54788522
Sequence TCAGTACGATGTGGTCATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190912862_1190912868 14 Left 1190912862 X:54788500-54788522 CCTCCATGACCACATCGTACTGA 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1190912868 X:54788537-54788559 CATGATGCCTGACCCAGAGATGG 0: 1
1: 0
2: 5
3: 34
4: 348
1190912862_1190912870 22 Left 1190912862 X:54788500-54788522 CCTCCATGACCACATCGTACTGA 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1190912870 X:54788545-54788567 CTGACCCAGAGATGGACGACTGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190912862 Original CRISPR TCAGTACGATGTGGTCATGG AGG (reversed) Exonic