ID: 1190913442

View in Genome Browser
Species Human (GRCh38)
Location X:54792275-54792297
Sequence CAGATCCACCATATGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190913442_1190913446 28 Left 1190913442 X:54792275-54792297 CCACACAGCATATGGTGGATCTG 0: 1
1: 0
2: 0
3: 16
4: 112
Right 1190913446 X:54792326-54792348 GTTGAATGAATTCTACCTTTTGG 0: 1
1: 0
2: 3
3: 15
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190913442 Original CRISPR CAGATCCACCATATGCTGTG TGG (reversed) Intronic
902219066 1:14953217-14953239 CAGAACCACCATGCGCTGAGTGG + Intronic
902512389 1:16973440-16973462 CAGAGCCACCCTATGCGGTTAGG - Intergenic
906536782 1:46555133-46555155 CAGATCCAGCAGATGCACTGAGG - Intergenic
908060509 1:60343172-60343194 CAAATCCAACTTCTGCTGTGGGG - Intergenic
912174933 1:107142577-107142599 CAGATTCACCATATGTTTAGTGG - Intronic
912710802 1:111948485-111948507 CAGAACAGCCCTATGCTGTGGGG - Intronic
914974621 1:152349868-152349890 CAGTGCAACCATATGCAGTGGGG - Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919621378 1:199867799-199867821 CAGACCCACCACACACTGTGAGG + Intergenic
921358532 1:214308691-214308713 CAACTCCACCATCTGCTGTGTGG - Intronic
923397386 1:233580526-233580548 CACAGCCACCAAATGCAGTGGGG - Intergenic
924471746 1:244348943-244348965 CAGGTACACCATGTGCTTTGGGG - Intergenic
1063752975 10:8973137-8973159 CAGATTGAGGATATGCTGTGTGG + Intergenic
1064287764 10:14007290-14007312 CAGAACCACCATATACTTTGTGG + Intronic
1064797659 10:19031545-19031567 CAGGTCCTCCATATGTCGTGTGG + Intergenic
1070343846 10:75522907-75522929 CAGAGCCAGCTTCTGCTGTGGGG - Intronic
1071878687 10:89870715-89870737 CAGATGCACCATAAGATGAGTGG + Intergenic
1072362581 10:94674285-94674307 CAGATTCAGCATCTGCTGTGGGG - Intergenic
1074228311 10:111509111-111509133 CACATCCACTACATGCTTTGTGG + Intergenic
1080661998 11:34304225-34304247 GAGGTCCAACATATGCTCTGTGG + Intronic
1083240530 11:61384665-61384687 CCCATCCTCCATATCCTGTGTGG - Intergenic
1090441974 11:126731840-126731862 TTGATCCAGCATATGCTGGGGGG - Intronic
1091609466 12:1992486-1992508 CACATGCACCTTATGCTTTGTGG - Intronic
1093737234 12:22635152-22635174 CAGGTCCAGCACAGGCTGTGAGG - Intronic
1096558944 12:52422370-52422392 CAGGTCCATCATGAGCTGTGTGG + Intergenic
1098921926 12:76310551-76310573 AAAATCCACCATAAGCTCTGAGG + Intergenic
1102227615 12:111240155-111240177 CAGCTCCACCATTGGCTGTGAGG - Intronic
1104069105 12:125329303-125329325 CAAATCCATCATAGGCTGGGAGG - Intronic
1104482739 12:129122272-129122294 CAGACATACCAGATGCTGTGGGG + Intronic
1104503033 12:129304005-129304027 AAGATCCACCCTCTGCAGTGTGG - Intronic
1112179557 13:97064566-97064588 CACTTCCACAATATGCTCTGAGG - Intergenic
1113637065 13:111926963-111926985 CAGAGCCACCACCTCCTGTGTGG + Intergenic
1115475058 14:33805509-33805531 CAGAAGCACCAAATACTGTGAGG - Intergenic
1122439311 14:101719149-101719171 CAAATGTACCATATGCTGTGAGG + Intergenic
1125679629 15:41522769-41522791 CAGATCCACAAGGGGCTGTGTGG - Exonic
1126380841 15:48045317-48045339 CAGATCCACCTTGTGTTGAGAGG - Intergenic
1127091008 15:55467379-55467401 CAGATCTACCATTAGCTGTATGG + Intronic
1128562379 15:68677398-68677420 CAGCTCCACCCTCTGCTGTGTGG - Intronic
1131254348 15:90852232-90852254 CGGATCCAACATTTGCTCTGTGG + Intergenic
1132418917 15:101647519-101647541 CAGAAGCACCACATGGTGTGTGG + Intronic
1136998894 16:35211369-35211391 CAGAACCACCAGTTGCTGTTGGG - Intergenic
1137870193 16:51942887-51942909 CACATCCACCTTAAGCAGTGGGG + Intergenic
1142432831 16:90039822-90039844 CAGATCCACCATTTGTGGGGCGG + Intronic
1142934536 17:3317419-3317441 CAAATCCAGCATCTTCTGTGTGG + Intergenic
1143326727 17:6103864-6103886 CAGATCCACCATATGGATGGAGG + Intronic
1143725126 17:8839386-8839408 CAGATCCCCAATGTGCTCTGTGG + Intronic
1145126889 17:20308421-20308443 CAGATTCCCCACATGCTTTGAGG - Intronic
1148699737 17:49580217-49580239 CAGATCCAGCACATGCTCTGCGG - Exonic
1150462620 17:65365097-65365119 CAGCTCCACCAAACCCTGTGCGG - Intergenic
1152000682 17:77643398-77643420 AAGATCCAACATACTCTGTGTGG + Intergenic
1152632138 17:81415082-81415104 CAGGGCCACCAGATGCTGCGCGG + Intronic
1152822230 17:82443267-82443289 CAGCTTCAGCATAAGCTGTGAGG - Exonic
1155056274 18:22186274-22186296 CAGTTCCACCTTCTGCTGGGAGG - Intronic
1157698646 18:49745308-49745330 CAGATGCCCCAGCTGCTGTGTGG + Intergenic
1159429574 18:68334304-68334326 TATATCCACTATATCCTGTGTGG - Intergenic
1159750222 18:72291829-72291851 CAAATACACCAAATGTTGTGAGG - Intergenic
1161483998 19:4525057-4525079 CAGATAGACCACATGCAGTGTGG - Exonic
1164188731 19:22896298-22896320 CAGATACAACATTTGCTATGTGG - Intergenic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1166767838 19:45263046-45263068 CTGAGCCACCATATCCAGTGGGG + Intronic
925472788 2:4180777-4180799 CAACCCCGCCATATGCTGTGTGG + Intergenic
926858672 2:17284779-17284801 CAGATCATTCATATACTGTGAGG - Intergenic
928336706 2:30404660-30404682 CACATCCACCAGATGCCGGGAGG + Intergenic
928449028 2:31361765-31361787 CAGATCCTCAATATGTTTTGAGG + Intronic
928640384 2:33292396-33292418 CAGAACCACCATTTTCTATGTGG + Intronic
930089329 2:47520534-47520556 AAGTTGCACCATATGCTTTGGGG + Exonic
931271709 2:60709258-60709280 CAGTACCACCCTATTCTGTGCGG + Intergenic
933811605 2:86036159-86036181 CAGCTCCACCACCTGCTGTTTGG + Intronic
933993502 2:87650577-87650599 CAGAACCACCACCTGCTGCGAGG - Intergenic
936300361 2:111300306-111300328 CAGAACCACCACCTGCTGCGAGG + Intergenic
944508804 2:200444352-200444374 TAGTTCCGCCATATGCTGGGGGG + Intronic
945001696 2:205358006-205358028 AAGATTCACCATATGAGGTGAGG - Intronic
946977854 2:225173633-225173655 CAAATGCAGCAGATGCTGTGAGG + Intergenic
946978047 2:225175049-225175071 CAAATGCAGCAGATGCTGTGAGG - Intergenic
947890735 2:233617008-233617030 CAGATACATCACATGCAGTGGGG - Intergenic
948789767 2:240371239-240371261 CAGCTCAGCCAAATGCTGTGGGG + Intergenic
1170115928 20:12859411-12859433 CAGTTCCACCATACGCTGTAGGG + Intergenic
1173411726 20:42817296-42817318 AAAAACCACCATATGCTGTTTGG - Intronic
1174483148 20:50845177-50845199 CAGCTCCACCATTTTCTGGGTGG - Intronic
1174624141 20:51900306-51900328 CTGGACCACCATATACTGTGTGG - Intergenic
1175902519 20:62365774-62365796 CAGATCCCCCATCTGAAGTGTGG + Intronic
1179507800 21:41853196-41853218 CAGGTCCACAATGGGCTGTGTGG - Intronic
1184644111 22:45886816-45886838 CACAGCCACCATATGGTGGGAGG + Intergenic
953255442 3:41286431-41286453 CAAGCCCACCATATGCTATGGGG + Intronic
955952068 3:64252353-64252375 CAGGTCAACCACATGCTATGGGG + Intronic
956618259 3:71194402-71194424 CATATACAGCATATGCTGTCAGG - Intronic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
962754427 3:138457214-138457236 CAGCTCCACCCTGTGCTGTGGGG + Intronic
965155432 3:165046945-165046967 CAGATCCAGCAAATGTTGAGCGG + Exonic
969246007 4:5933442-5933464 CATATTCCCCATCTGCTGTGGGG + Intronic
971026888 4:22597907-22597929 CGGGTCCTCCATATGCTGAGCGG - Intergenic
971288667 4:25314445-25314467 CAGAAGTACCATAGGCTGTGTGG + Intronic
974621195 4:64356726-64356748 CAGGTCCTCCATATGCTAGGTGG + Intronic
978027678 4:103897257-103897279 CAGGTTCACCATATCCTGTGGGG - Intergenic
981570846 4:146148913-146148935 CAGATCCAACATCTTCTGGGTGG - Intergenic
982977107 4:162077523-162077545 CAGATCCAGCATAGCCTGTGGGG + Intronic
990056094 5:51580687-51580709 CAAATCCACCATTTGCTGCCTGG - Intergenic
992349128 5:75911346-75911368 CAGATCCTTCATTTTCTGTGCGG - Intergenic
995444941 5:112232148-112232170 GAGATCCACCTGATGCTGGGAGG + Intronic
995627715 5:114097460-114097482 CAGATCCACCATAATCCATGAGG - Intergenic
995866252 5:116694718-116694740 AATATGCACCATATGCTTTGGGG - Intergenic
1000700999 5:164449897-164449919 AATATCCACAATATGCTGTAAGG + Intergenic
1005066915 6:21827258-21827280 AAGACCCACCATATACCGTGTGG - Intergenic
1006148246 6:31971866-31971888 CAGGTCCTCCAAATGCAGTGAGG + Intronic
1006372470 6:33653873-33653895 GAGATCCACAAAATGATGTGGGG + Intronic
1007822169 6:44568773-44568795 CAGATCCACCCTACTCAGTGGGG + Intergenic
1015221720 6:130811994-130812016 CAGAACCACCATATTTTGTGAGG + Intergenic
1016581027 6:145629515-145629537 CAGATCCACTATTTGCGCTGGGG + Intronic
1021874914 7:25039483-25039505 CATAACCACCAAATGCAGTGTGG - Intergenic
1022381697 7:29866516-29866538 CAGAGTAACCCTATGCTGTGTGG - Intronic
1023478864 7:40611167-40611189 CAGAATAACCATATGCTTTGAGG + Intronic
1030672152 7:112349662-112349684 CACATCCACCATTTGCTAAGAGG - Intergenic
1032352966 7:131183026-131183048 CACATCCACCTGATGCTGTGTGG - Intronic
1032478066 7:132225820-132225842 CATCTCCACCATCTGTTGTGGGG - Intronic
1036729185 8:11246838-11246860 CAGCTCCACCCCTTGCTGTGTGG + Intergenic
1036751327 8:11445271-11445293 CAGACCCACCTTAGCCTGTGTGG - Intronic
1040678268 8:49778032-49778054 TATATCAACCAAATGCTGTGGGG + Intergenic
1041649473 8:60287674-60287696 CATATCCACCAAACGCTGTTGGG + Intergenic
1043965550 8:86470652-86470674 CATATCAACCATATGCTGAGGGG - Intronic
1045333250 8:101175622-101175644 CATATCCATCATATAATGTGAGG + Intergenic
1048182422 8:132208358-132208380 CAAAGCCACAAAATGCTGTGCGG - Intronic
1048769953 8:137884560-137884582 CAGATCCAACATGTGCTGACAGG - Intergenic
1060219664 9:121757663-121757685 CAGATCCCCCATTTCCTATGAGG - Intronic
1185631518 X:1518979-1519001 CAGATCCCCAATATTCTCTGTGG + Intronic
1187360562 X:18623145-18623167 CAAAGTCACCATATGCTCTGAGG - Intronic
1189338391 X:40185634-40185656 CAGCTCCATCATGTTCTGTGTGG + Intergenic
1190913442 X:54792275-54792297 CAGATCCACCATATGCTGTGTGG - Intronic
1192743408 X:73915123-73915145 CAAATCCACCCAATGATGTGAGG - Intergenic
1193819676 X:86147365-86147387 TCTAACCACCATATGCTGTGTGG + Intergenic