ID: 1190918092

View in Genome Browser
Species Human (GRCh38)
Location X:54824870-54824892
Sequence TCAGTACGATGTGGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918081_1190918092 27 Left 1190918081 X:54824820-54824842 CCCGACATTGCAAGACCAGTTGG No data
Right 1190918092 X:54824870-54824892 TCAGTACGATGTGGTCATGGAGG No data
1190918086_1190918092 12 Left 1190918086 X:54824835-54824857 CCAGTTGGCTCAGGCATCATGGC No data
Right 1190918092 X:54824870-54824892 TCAGTACGATGTGGTCATGGAGG No data
1190918083_1190918092 26 Left 1190918083 X:54824821-54824843 CCGACATTGCAAGACCAGTTGGC No data
Right 1190918092 X:54824870-54824892 TCAGTACGATGTGGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918092 Original CRISPR TCAGTACGATGTGGTCATGG AGG Intergenic