ID: 1190918099

View in Genome Browser
Species Human (GRCh38)
Location X:54824905-54824927
Sequence CCCAGGCCCCCTCACCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918099_1190918106 -4 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918106 X:54824924-54824946 TGGGGAAGAGGAGAGAGGATGGG No data
1190918099_1190918105 -5 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG No data
1190918099_1190918108 13 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918108 X:54824941-54824963 GATGGGCTCTGGAGTCAGACAGG No data
1190918099_1190918107 2 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918107 X:54824930-54824952 AGAGGAGAGAGGATGGGCTCTGG No data
1190918099_1190918103 -9 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918103 X:54824919-54824941 GGGCCTGGGGAAGAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918099 Original CRISPR CCCAGGCCCCCTCACCTGCA CGG (reversed) Intergenic
No off target data available for this crispr