ID: 1190918105

View in Genome Browser
Species Human (GRCh38)
Location X:54824923-54824945
Sequence CTGGGGAAGAGGAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918099_1190918105 -5 Left 1190918099 X:54824905-54824927 CCGTGCAGGTGAGGGGGCCTGGG No data
Right 1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918105 Original CRISPR CTGGGGAAGAGGAGAGAGGA TGG Intergenic
No off target data available for this crispr