ID: 1190918340

View in Genome Browser
Species Human (GRCh38)
Location X:54826521-54826543
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918340_1190918347 16 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918347 X:54826560-54826582 TACCTGGTGTTGGCTGACGTTGG No data
1190918340_1190918351 29 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918340_1190918350 28 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918350 X:54826572-54826594 GCTGACGTTGGGAACCCCAAAGG No data
1190918340_1190918346 6 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918346 X:54826550-54826572 ATCTGTGTCATACCTGGTGTTGG No data
1190918340_1190918344 0 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918340_1190918348 17 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918348 X:54826561-54826583 ACCTGGTGTTGGCTGACGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918340 Original CRISPR CTCAGTGAGCCCCAGCGGGG TGG (reversed) Intergenic
No off target data available for this crispr