ID: 1190918344

View in Genome Browser
Species Human (GRCh38)
Location X:54826544-54826566
Sequence CACCTCATCTGTGTCATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918341_1190918344 -3 Left 1190918341 X:54826524-54826546 CCCCGCTGGGGCTCACTGAGCAC No data
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918336_1190918344 20 Left 1190918336 X:54826501-54826523 CCAGCACATCATCAGATCATCCA 0: 2
1: 0
2: 0
3: 12
4: 133
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918340_1190918344 0 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918343_1190918344 -5 Left 1190918343 X:54826526-54826548 CCGCTGGGGCTCACTGAGCACCT No data
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918342_1190918344 -4 Left 1190918342 X:54826525-54826547 CCCGCTGGGGCTCACTGAGCACC No data
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data
1190918335_1190918344 21 Left 1190918335 X:54826500-54826522 CCCAGCACATCATCAGATCATCC 0: 2
1: 0
2: 0
3: 11
4: 141
Right 1190918344 X:54826544-54826566 CACCTCATCTGTGTCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918344 Original CRISPR CACCTCATCTGTGTCATACC TGG Intergenic
No off target data available for this crispr