ID: 1190918345

View in Genome Browser
Species Human (GRCh38)
Location X:54826546-54826568
Sequence CACCAGGTATGACACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918345_1190918351 4 Left 1190918345 X:54826546-54826568 CCTCATCTGTGTCATACCTGGTG No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918345_1190918350 3 Left 1190918345 X:54826546-54826568 CCTCATCTGTGTCATACCTGGTG No data
Right 1190918350 X:54826572-54826594 GCTGACGTTGGGAACCCCAAAGG No data
1190918345_1190918348 -8 Left 1190918345 X:54826546-54826568 CCTCATCTGTGTCATACCTGGTG No data
Right 1190918348 X:54826561-54826583 ACCTGGTGTTGGCTGACGTTGGG No data
1190918345_1190918347 -9 Left 1190918345 X:54826546-54826568 CCTCATCTGTGTCATACCTGGTG No data
Right 1190918347 X:54826560-54826582 TACCTGGTGTTGGCTGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918345 Original CRISPR CACCAGGTATGACACAGATG AGG (reversed) Intergenic
No off target data available for this crispr