ID: 1190918351

View in Genome Browser
Species Human (GRCh38)
Location X:54826573-54826595
Sequence CTGACGTTGGGAACCCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190918340_1190918351 29 Left 1190918340 X:54826521-54826543 CCACCCCGCTGGGGCTCACTGAG No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918343_1190918351 24 Left 1190918343 X:54826526-54826548 CCGCTGGGGCTCACTGAGCACCT No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918341_1190918351 26 Left 1190918341 X:54826524-54826546 CCCCGCTGGGGCTCACTGAGCAC No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918345_1190918351 4 Left 1190918345 X:54826546-54826568 CCTCATCTGTGTCATACCTGGTG No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data
1190918342_1190918351 25 Left 1190918342 X:54826525-54826547 CCCGCTGGGGCTCACTGAGCACC No data
Right 1190918351 X:54826573-54826595 CTGACGTTGGGAACCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190918351 Original CRISPR CTGACGTTGGGAACCCCAAA GGG Intergenic
No off target data available for this crispr