ID: 1190919489

View in Genome Browser
Species Human (GRCh38)
Location X:54838883-54838905
Sequence CAGGCCCTAGGTGGGTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190919478_1190919489 20 Left 1190919478 X:54838840-54838862 CCAGCAAGGCCTGTGTCCTTTGC No data
Right 1190919489 X:54838883-54838905 CAGGCCCTAGGTGGGTCTAGAGG No data
1190919481_1190919489 11 Left 1190919481 X:54838849-54838871 CCTGTGTCCTTTGCTTTTGGGTA No data
Right 1190919489 X:54838883-54838905 CAGGCCCTAGGTGGGTCTAGAGG No data
1190919482_1190919489 4 Left 1190919482 X:54838856-54838878 CCTTTGCTTTTGGGTAGTGAGTT No data
Right 1190919489 X:54838883-54838905 CAGGCCCTAGGTGGGTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190919489 Original CRISPR CAGGCCCTAGGTGGGTCTAG AGG Intergenic
No off target data available for this crispr