ID: 1190929159

View in Genome Browser
Species Human (GRCh38)
Location X:54933778-54933800
Sequence GCTGTGTCCACAGCCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190929156_1190929159 8 Left 1190929156 X:54933747-54933769 CCTTTCTGTGGATAAGGTGCTTT 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1190929159 X:54933778-54933800 GCTGTGTCCACAGCCAGCTTGGG 0: 2
1: 0
2: 2
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190929159 Original CRISPR GCTGTGTCCACAGCCAGCTT GGG Intronic
900530318 1:3149798-3149820 GCTGTGTCCCCAGCCAGCCCAGG - Intronic
900659291 1:3774753-3774775 GCTGTGTCCTCAGCCTGTGTGGG - Intronic
900811060 1:4801697-4801719 GCTGTTTCCACGGCCAACTGGGG + Intergenic
901637905 1:10678942-10678964 GCTGTCTGCAGAGCCAGCCTGGG + Intronic
902686178 1:18079193-18079215 TCTCTGGCCACACCCAGCTTGGG - Intergenic
903364836 1:22799784-22799806 GCTGTGTCCCCAGCAAATTTTGG + Intronic
903463008 1:23532049-23532071 GCTGTGCCCCCAGGCAGCTTGGG - Intergenic
903487927 1:23705344-23705366 GTTGTATGCACAGCCAGATTTGG + Intergenic
903649199 1:24912815-24912837 GCGGGGTTCACAGCCAGCCTGGG + Intronic
904287147 1:29460134-29460156 GCTGCCTGCACAGCCAGCTGTGG + Intergenic
904935018 1:34123908-34123930 GTTGTGAACACAGGCAGCTTAGG + Intronic
905695833 1:39972913-39972935 GCTGTGACCAGAGCAGGCTTTGG + Intergenic
906194295 1:43920391-43920413 GCTGTGTCCACAGAGTGCATCGG + Exonic
907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG + Intronic
907426164 1:54380556-54380578 GCTCTGGCCAGGGCCAGCTTCGG + Intronic
909656974 1:78043531-78043553 GCTGTGTCCCCAGGCAACATAGG + Intronic
912159327 1:106961983-106962005 GCTGTTTCCTCAGCCATTTTAGG + Intergenic
912189414 1:107320251-107320273 GCTTTGTCCACAATCAGCTAAGG + Intronic
912204162 1:107492309-107492331 GCTGTGTCACCAGCCAGGCTAGG - Intergenic
912511855 1:110195136-110195158 GCTGTGTCCACAGTTCCCTTCGG + Intronic
912996688 1:114538003-114538025 GCTGTGTTTACAGCCTGCTCTGG + Intergenic
913129827 1:115829168-115829190 GCTGTGTTGACAGCGAGGTTAGG + Intergenic
914244203 1:145873546-145873568 GCTGAGTCCTCAGCCTTCTTTGG + Exonic
914452228 1:147802782-147802804 GCTCAGTGCACAGCCTGCTTGGG - Intergenic
915037370 1:152940096-152940118 GTTGTGTCTCCACCCAGCTTTGG - Intergenic
915469239 1:156115724-156115746 CATGTGTTCAGAGCCAGCTTGGG - Intronic
919658676 1:200222035-200222057 GCTCTGCCCACAGTCAGCTGTGG - Intergenic
919944053 1:202307155-202307177 CCTGGGGCCACAGCCAGCTCAGG + Intronic
920118753 1:203639690-203639712 GCTGGACCCACACCCAGCTTCGG - Intronic
920560698 1:206936393-206936415 GCCATGTCCACATCCAGCTCTGG - Intronic
921235130 1:213119045-213119067 ACTGAGGCAACAGCCAGCTTAGG - Intronic
921559144 1:216635809-216635831 GCTATGTTCACAGCAGGCTTAGG - Intronic
921893980 1:220380006-220380028 GCTGTGCCCACAGACAGGTCAGG - Intergenic
923084888 1:230695693-230695715 GCTGAGTCCAGGGCCAGCCTGGG - Intergenic
1062913386 10:1229091-1229113 GCTGTGTCACCTGCTAGCTTCGG - Intronic
1063223276 10:3991181-3991203 CCTCTGTCCACAGCTAGCTCAGG - Intergenic
1063482365 10:6386752-6386774 GCAGTGTCCACATCCAGCAGTGG - Intergenic
1065848532 10:29766655-29766677 CCTGAGTCCACAGCCACTTTTGG - Intergenic
1066229391 10:33417594-33417616 TCTCCGTCCACAGCCAGCCTCGG + Intergenic
1069209800 10:65741935-65741957 GATGTGTCCATAGCCAGGATGGG + Intergenic
1069541346 10:69296369-69296391 GTTGAATCCACACCCAGCTTTGG - Intronic
1069706060 10:70459627-70459649 GCTGTGCGCGGAGCCAGCTTAGG + Intergenic
1070757414 10:79001899-79001921 TCAGTTTCCACAGCCATCTTAGG - Intergenic
1070961830 10:80505032-80505054 GCTGTGCCCAGAGCAGGCTTGGG + Intronic
1071840690 10:89468136-89468158 GCTATCACCACAGCCATCTTGGG - Intronic
1072493918 10:95935729-95935751 GCTGTGTCCCCCGCTAACTTTGG + Intronic
1072537828 10:96376803-96376825 CTTGTGTGCACAGCCAGCTGGGG + Exonic
1072898418 10:99387293-99387315 GCTGTGGTCCCAGCCAGCATAGG + Intronic
1076052871 10:127349222-127349244 GCAGTGCCCAGAGCCAGCATCGG - Intronic
1076484599 10:130807963-130807985 CCTGTGCCCACAGCCAGCCTGGG + Intergenic
1076631162 10:131853179-131853201 TCTGTTTCCACAGCCAGCAAAGG + Intergenic
1076647658 10:131964380-131964402 GCTGTGTGCACGGCCAGCCCTGG - Intergenic
1076992379 11:282233-282255 GTTGGGTCCCCAGCCAGCTGGGG - Intronic
1077821419 11:5745921-5745943 GGTGTGTCCTTACCCAGCTTTGG + Intronic
1077896286 11:6456112-6456134 GGTGTGTCCGCAGCCAGCAGCGG - Exonic
1079005415 11:16788519-16788541 GCCCTGTCCACAGTCACCTTAGG - Exonic
1080663982 11:34319533-34319555 GCTGACTCCACAGCCCGCCTTGG - Intronic
1080774539 11:35373331-35373353 GCTGTTTCCATAGCCAGGTTGGG + Intronic
1080851610 11:36075041-36075063 ACTGTCTGCACAGCCAGTTTAGG - Intronic
1082937865 11:58673285-58673307 TCTGTGTCCACAGACTGCCTGGG - Intronic
1083169717 11:60915840-60915862 GCTGTTTCCCCAGCCAGGCTGGG + Intronic
1083446228 11:62709567-62709589 GCTGTGGGCGCAGCCATCTTAGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084166893 11:67379339-67379361 GCTGACATCACAGCCAGCTTAGG - Intronic
1084313839 11:68332342-68332364 GATGGGTCCACGGCCAGCATTGG + Intronic
1085261607 11:75208671-75208693 TCTCTCCCCACAGCCAGCTTGGG + Intergenic
1085426706 11:76411236-76411258 TCAGTTTCCACAGCCAGCCTGGG + Intronic
1086960923 11:92979667-92979689 ACTGTGTCCACAGCTAGGTTAGG - Intronic
1087181586 11:95147490-95147512 GATGTGTAAACAGCCAACTTAGG + Intergenic
1090060646 11:123461567-123461589 GCTGTCTCAACAACCAGCTGGGG - Intergenic
1091149276 11:133311900-133311922 GCTGGGGCCACAGCCAGAGTAGG + Intronic
1091170400 11:133515345-133515367 GCTGTGTCTAGAGACATCTTGGG + Intronic
1091517768 12:1202207-1202229 GCTGTGCCCACAGGAAACTTTGG - Intronic
1096413221 12:51391752-51391774 GCCGTGTCCTCAGCCTGCTGCGG + Intronic
1100616395 12:96234848-96234870 GCTGTGTCGCCCTCCAGCTTTGG - Intronic
1104612683 12:130242542-130242564 GCTGTGTGGACAGGCAGCTGCGG - Intergenic
1104658883 12:130594617-130594639 GCTGTGTTCAAAGCCATCCTGGG + Intronic
1105069382 12:133225553-133225575 GCTGTGTCCATTGCCACCCTTGG - Intronic
1105970329 13:25423915-25423937 GTTGTGTCCACTGACAGCGTGGG + Intronic
1108156684 13:47592393-47592415 CCTGTGTGCAATGCCAGCTTGGG - Intergenic
1108713899 13:53060127-53060149 GCAGTGATCACAGCCAGCATCGG - Intergenic
1110924796 13:81137951-81137973 GCTGTGTCCCCAGTCAGAGTGGG - Intergenic
1112308974 13:98301037-98301059 GCTGGGTCCAGAGACTGCTTTGG + Intronic
1113427758 13:110223681-110223703 GCTGTGCCAACACCTAGCTTCGG - Intronic
1113528612 13:111002733-111002755 GCTGTGCCCCCAACCACCTTGGG - Intergenic
1113695949 13:112345560-112345582 GCTGTCTCCCCAGCAAGTTTAGG + Intergenic
1114052652 14:18934184-18934206 ACTGTTTCCACAGTCAGCGTGGG + Intergenic
1114109906 14:19467741-19467763 ACTGTTTCCACAGTCAGCGTGGG - Intergenic
1115459027 14:33638320-33638342 GCTGTGCTCACAGCCAGCCATGG - Intronic
1115514108 14:34168091-34168113 GCTGTGGCCACAGCCTCCTCTGG + Intronic
1117487388 14:56212168-56212190 TATGTCTCCAAAGCCAGCTTGGG + Intronic
1117968447 14:61229414-61229436 GCAGATTCCACAGCTAGCTTTGG - Intronic
1119077975 14:71663558-71663580 ACAGTGGCCACAGCCAGCTGTGG - Intronic
1119200283 14:72746933-72746955 GCTGAGTTCACAGCCTGCTTTGG - Intronic
1119483248 14:74973096-74973118 GCTGAGGGCACAGCCAACTTGGG + Intergenic
1121359426 14:93242985-93243007 TCTGTGTCTACAGCAAGCTCTGG + Exonic
1121723174 14:96126392-96126414 GCTGTATCCTCAGCCAGCTCTGG - Intergenic
1122098746 14:99390523-99390545 GCTTTGGCCACAGGCAGCTGGGG + Intergenic
1122155932 14:99750393-99750415 GCTATGTCCTCACCCAGCTGGGG + Intronic
1123133307 14:106005768-106005790 GCTCTGTCAACATACAGCTTAGG - Intergenic
1123583331 15:21736184-21736206 GCTCTGTCAACATACAGCTTAGG - Intergenic
1123619981 15:22178781-22178803 GCTCTGTCAACATACAGCTTAGG - Intergenic
1123631449 15:22262954-22262976 GGTGTGGCCTCAGCCAGCCTGGG + Intergenic
1123699436 15:22903531-22903553 TCTGTGTGCACAGGCAGCCTCGG - Intronic
1124074610 15:26433121-26433143 GCTGTGCCCACAGACCCCTTGGG + Intergenic
1125408962 15:39384750-39384772 TCTCTGTCCACAGACAGCTGTGG + Intergenic
1127148288 15:56048333-56048355 GATGTGTCCATAGCCAGCCAAGG + Intergenic
1128090759 15:64917243-64917265 GCTGGGTCCCCAGCTAGCTGGGG + Intronic
1131151879 15:90052320-90052342 GCTGGGGCCACAGCCATCATCGG + Intronic
1131779352 15:95839924-95839946 GTGGTGTCCACAGCCCGCATCGG + Intergenic
1132323065 15:100941650-100941672 GCTGTGTTCACAGACAGCTACGG - Intronic
1132381829 15:101371554-101371576 GCTCAGTGCACAGTCAGCTTGGG - Intronic
1132761775 16:1512038-1512060 TCTGTGTGCAGAGCTAGCTTCGG + Intronic
1133304349 16:4800381-4800403 TCTGTGGCCACAGCAAGCCTGGG - Intronic
1133560391 16:6945172-6945194 GCTGTGACCTCAGACTGCTTAGG + Intronic
1135464456 16:22673236-22673258 GCTGTGTCAAGGGGCAGCTTGGG - Intergenic
1136276403 16:29181591-29181613 GCTGTGCCCCCTGCCAGCTAGGG + Intergenic
1137624547 16:49899619-49899641 CCTGTGTCCCCAGGGAGCTTGGG + Intergenic
1138546495 16:57722691-57722713 GCTGTGGACACAGTCAGCTGTGG - Exonic
1139364649 16:66426365-66426387 GCTCTGTCCCCACCCTGCTTTGG - Intergenic
1139588186 16:67917729-67917751 CCTGTGCCCACAGGCAGCTGTGG - Intronic
1141218388 16:82046109-82046131 GCTGTGAAAACAACCAGCTTCGG - Intronic
1141673346 16:85504398-85504420 GCTGTCCTCACACCCAGCTTTGG - Intergenic
1141971560 16:87487517-87487539 GGTGTGGCCTCAGCCAGCCTGGG - Intronic
1142080786 16:88147651-88147673 GCTGTGCCCCCTGCCAGCTAGGG + Intergenic
1143782674 17:9237607-9237629 GTGGTGTCCCCAGCCAGCATGGG - Intronic
1148326938 17:46788839-46788861 GCTGTCTCCACGGCGAGCTGAGG + Intronic
1149532997 17:57410361-57410383 GCTGGGTAAACAGCCAGCATGGG + Intronic
1150286964 17:63960151-63960173 CCTGGGTCCACAGCCTGCCTGGG + Intronic
1150625924 17:66841091-66841113 GCTGTGCCCCCAACCACCTTGGG - Intronic
1151547378 17:74801386-74801408 GAGGTGTCTTCAGCCAGCTTTGG + Intronic
1151547394 17:74801475-74801497 GAGGTGTCTTCAGCCAGCTTTGG + Intronic
1151956549 17:77382995-77383017 GCTGTGGCCACAGCCAGGGCTGG - Intronic
1152632341 17:81415882-81415904 GCTCTGCCCACAGCCATCCTGGG - Intronic
1152661292 17:81543492-81543514 GCTGTGCCCAGAGCCAGCTTGGG - Intronic
1156268390 18:35508740-35508762 GCTGTGCAGGCAGCCAGCTTGGG - Intergenic
1157430553 18:47620901-47620923 GCTATTTCCACAGCCTGCTCAGG + Intergenic
1157478665 18:48038992-48039014 GATCTGCCCACTGCCAGCTTTGG - Intronic
1157539061 18:48486390-48486412 GCTGTGTCCCCAGCCAGCCCTGG + Intergenic
1159399313 18:67910118-67910140 GCTGCATTCAAAGCCAGCTTGGG + Intergenic
1160901928 19:1433082-1433104 GCTGGGTCCAGACCCCGCTTGGG + Intronic
1160904319 19:1445380-1445402 GCTCTGTCCACAGCCCGCGGTGG + Intergenic
1161058070 19:2200519-2200541 GCTGTGGCCACACCCAGGCTGGG - Intronic
1163748055 19:19059668-19059690 GCTGGGACCACAGACAGGTTTGG - Intronic
1164438280 19:28251247-28251269 CCTGGGCCCACACCCAGCTTCGG + Intergenic
1164867929 19:31620342-31620364 GGTCTGCCCACAGCCAGCATTGG - Intergenic
1164987713 19:32660928-32660950 GCTGTGATTACAGCCAGCCTGGG - Intronic
1165102248 19:33445876-33445898 GCTGTGGCCAGAGCTGGCTTGGG - Intronic
1165750057 19:38253959-38253981 CATGTGTCCACAGTCAGCTGTGG + Intronic
1166897795 19:46035035-46035057 GCTGTCTCCACTGCCAGGTCAGG + Intergenic
1167068072 19:47202043-47202065 GCTGTGTCCAAAGGCACCTCCGG - Intronic
928306169 2:30172103-30172125 GCAGTGAGCACACCCAGCTTAGG + Intergenic
928978573 2:37115387-37115409 GCTGTGCCCAGAGCCACCTCTGG - Intronic
929048121 2:37810627-37810649 TCTGTGCCCTCTGCCAGCTTGGG - Intergenic
931203883 2:60128111-60128133 GCTAGGTCAACAGCCAGCCTGGG - Intergenic
931705644 2:64944264-64944286 GCTCTGTCCCCAACCAGCTTTGG - Intergenic
933372511 2:81433640-81433662 GCTGCGTTCAAAGCCATCTTGGG - Intergenic
934859200 2:97749801-97749823 ACTGGGTCCACCGCCAGCCTGGG - Intergenic
935697828 2:105785383-105785405 CCTGTGTCCACAGACATCTCAGG - Intronic
939637025 2:144594595-144594617 GTTGTTTCCACAGCCTGTTTTGG + Intergenic
941067623 2:160920964-160920986 GCTCTGACCACTGCCTGCTTAGG - Intergenic
943755420 2:191551947-191551969 ATTGTGTCCCCAGCCAGCATAGG + Intergenic
944254863 2:197615320-197615342 GATGTGTCCTCTGCCCGCTTTGG - Intronic
944665483 2:201955738-201955760 TCTGTCTCCACTGCCAGCTCTGG - Intergenic
947321288 2:228921699-228921721 CCAGTTTCCACTGCCAGCTTTGG - Intronic
1169140415 20:3224454-3224476 TCTGTGCCCACAGGCAGCTCTGG + Intergenic
1170585043 20:17728196-17728218 GCTGTGCACAAAGCCACCTTGGG + Intronic
1172231236 20:33337701-33337723 CCTGTGGGCTCAGCCAGCTTGGG - Intergenic
1173582912 20:44159987-44160009 GCCGCGTCCACCGCCAGCCTGGG - Exonic
1175829103 20:61952331-61952353 GCTGTGTCCTCAGGCTGCTGAGG - Intergenic
1176932405 21:14829252-14829274 GCTGTGTTCACAGGAAGCTGTGG + Intergenic
1177051706 21:16243668-16243690 ACTGTGTTTACAGACAGCTTAGG + Intergenic
1179025679 21:37676586-37676608 GCTGTGCACAGGGCCAGCTTGGG + Intronic
1179104223 21:38383901-38383923 GCAGTGGCCAGATCCAGCTTTGG - Exonic
1179261123 21:39758747-39758769 GGGGTTTTCACAGCCAGCTTTGG + Intronic
1179503604 21:41825066-41825088 GCTGGGCCCAGAGCCCGCTTGGG + Intronic
1179799562 21:43804609-43804631 GCTGTGGCCACAGCCTGCATAGG + Exonic
1179973634 21:44850554-44850576 GGTGTGTCCAGAGTCAGCTGAGG - Exonic
1180471126 22:15656559-15656581 ACTGTTTCCACAGTCAGCGTGGG + Intergenic
1181267570 22:21639720-21639742 GCTGTGTCCTCAGCCTCCTACGG + Intergenic
1181427085 22:22850729-22850751 GCTTTGTCCACAGCCATCCTGGG - Intronic
1181429997 22:22873564-22873586 GCTGTGACCACAGTCCTCTTGGG - Intronic
1181527215 22:23496880-23496902 GGGGTCTCCACAGCCAGCTCAGG + Intergenic
1181965684 22:26655177-26655199 GCTGTGTCTAAAGCCTCCTTGGG + Intergenic
1182092272 22:27603977-27603999 CCTGGGACCACAGCCAGCTGGGG - Intergenic
1184331881 22:43832732-43832754 GCTCTGTTCACAGCCAGGTCTGG + Intronic
1185013511 22:48330386-48330408 GCTCTGTCCACCACCAGCTTGGG + Intergenic
1185057220 22:48587369-48587391 GCTGTGTCCTCAGCCACACTGGG + Intronic
1185277105 22:49954538-49954560 GCTCTGCCCACAGACAGCTCAGG - Intergenic
1185342444 22:50297664-50297686 GGTGTGACCACAGCCACCTAAGG - Intronic
950131872 3:10552826-10552848 GCTGAGGCCACAGACAGCTCAGG + Intronic
951963142 3:28351036-28351058 GCTGTGTCCAAGGCCAAGTTTGG + Intronic
952812314 3:37415436-37415458 GCTGTGTTAACAGTCAGGTTAGG - Intronic
953674495 3:44990138-44990160 GCAGTGTCTGCAGCCAGCCTTGG + Intronic
953855734 3:46498057-46498079 TCTGTGTCCCCAGCCATCTCTGG - Exonic
954576197 3:51677678-51677700 CCTGGGTCCACACCCAGCCTAGG - Intronic
954648122 3:52143762-52143784 GCGGTGTCCAGAGCCTGCTGGGG - Intronic
954796760 3:53165415-53165437 TCTGGGGCCACAGCCAGGTTAGG - Intronic
956848879 3:73209724-73209746 GATGTTTCCAAAGCCATCTTTGG + Intergenic
958577521 3:95971866-95971888 GATGTGGCCAGAGCCAGCCTTGG - Intergenic
958944941 3:100352463-100352485 GCTGTGTCCCCAGGCAACATAGG - Exonic
961402578 3:126657648-126657670 CCTGTGTCCCCAGCCAGTTATGG + Intergenic
961514339 3:127423335-127423357 GCTCTGTCTCCTGCCAGCTTTGG - Intergenic
962441127 3:135417115-135417137 CCTGTATGCACAGGCAGCTTTGG + Intergenic
963862408 3:150324681-150324703 TCTGTGGCCCCAGGCAGCTTGGG - Intergenic
964835667 3:160935894-160935916 GCTGTGTCCTCAGCCACCATTGG + Intronic
965499530 3:169441132-169441154 GCTGTCACATCAGCCAGCTTGGG - Intronic
965693577 3:171383171-171383193 CCTGTATCATCAGCCAGCTTTGG - Intronic
966764408 3:183447374-183447396 GCTCTGTCCCCAGCCTCCTTAGG - Intergenic
966807625 3:183819217-183819239 GCTGTGTCCATGGCCAGCACTGG + Intronic
968915990 4:3497293-3497315 GCTGTGTCCTCAGACAGCGGTGG + Intronic
970579104 4:17458041-17458063 GCTGTGTCCTCAGACAGCAGAGG - Intergenic
972399878 4:38690872-38690894 GTTGTATCCACATTCAGCTTGGG + Intronic
973623847 4:52751745-52751767 CCTGTGTCCACTGCCTGCCTAGG + Intergenic
973867411 4:55127299-55127321 GCTTTGTTCGCAGCCAGCTTAGG - Intergenic
975447264 4:74480462-74480484 GCTGTGTTCCCAGACAGGTTTGG + Intergenic
975605624 4:76151083-76151105 GCAGTGTCTACAGACAGTTTTGG + Intergenic
976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG + Intergenic
979542640 4:121903452-121903474 GCTGTGTCTACAGCCTGGCTTGG - Intronic
980828677 4:138103165-138103187 GCAAATTCCACAGCCAGCTTGGG + Intergenic
985531127 5:434380-434402 GCTGTGTGCCCAGCCAGGTGTGG + Exonic
985717088 5:1468797-1468819 TCTGTGTCCACAGTCAGCCTGGG + Intronic
986070143 5:4274801-4274823 GGGGTCTCCACAGCCACCTTTGG + Intergenic
993504308 5:88692336-88692358 ACTGTGAGCACAGCCCGCTTGGG + Intergenic
995186633 5:109279206-109279228 ACTGTGTCCACAGCCAGCCTAGG + Intergenic
996775796 5:127131097-127131119 GCTCTCTCCACAGTCTGCTTAGG + Intergenic
997438384 5:133891462-133891484 GCAGTGACAACAGCCACCTTTGG - Intergenic
997978526 5:138454427-138454449 GCTGTGCCCAGAGCCAGTGTGGG + Intergenic
998321886 5:141240495-141240517 GCTTTGTCCAGAACCAGCTCTGG - Intergenic
999268545 5:150282874-150282896 CCTGAGGCCACAGCCAGCTGTGG + Intronic
1002324754 5:178397078-178397100 GCTGGGTGCACAGCCAGGCTTGG - Intronic
1002417517 5:179128163-179128185 GCTTCCTCCCCAGCCAGCTTAGG + Intronic
1002859389 6:1066619-1066641 GCTCTGGCCTCTGCCAGCTTTGG + Intergenic
1005303866 6:24495375-24495397 GCCGTGTCCCCGGCCAGCTCTGG - Intronic
1007212668 6:40208006-40208028 GCTGTTTTCACTGCCTGCTTGGG - Intergenic
1009981778 6:70734625-70734647 GCTGGCTCCACAGCGGGCTTTGG + Intronic
1012931091 6:105317650-105317672 ACTGTGTCCACATCCTGCTCAGG + Intronic
1015898956 6:138045087-138045109 GCTCTGTCCACGTCCATCTTAGG - Intergenic
1016008066 6:139109545-139109567 GCTGTGTCCCCACCCAAATTGGG + Intergenic
1016571860 6:145522276-145522298 TCTGTCTACACATCCAGCTTAGG + Intronic
1018568553 6:165183635-165183657 GCTGTGGCTGCAGCCAGCTAAGG + Intergenic
1018872132 6:167791238-167791260 GCTGTGTCCTCAGGGAACTTAGG + Intronic
1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG + Intergenic
1019600373 7:1880291-1880313 GATGGGGCCACAGACAGCTTTGG + Intronic
1019606110 7:1911016-1911038 GCTGTGGGCACAGGCAGCTGAGG - Intronic
1026942734 7:74297068-74297090 TCTGTGTCCTCAGTCAGCTTGGG + Intronic
1028964220 7:96783774-96783796 GTTGTCTCTGCAGCCAGCTTGGG - Intergenic
1031744980 7:125484353-125484375 GCAGTGTCCAAAGTCAGCATAGG + Intergenic
1033134435 7:138773215-138773237 TCTGTGTCCTCCTCCAGCTTTGG + Intronic
1035224001 7:157423781-157423803 GCTCTGTCCACAGCCAGTGTGGG - Intergenic
1035913309 8:3593212-3593234 TCTGTCTCCTCACCCAGCTTGGG - Intronic
1036687180 8:10919404-10919426 GCTGTGTCCCCAGACAGAATGGG + Intronic
1037321031 8:17642840-17642862 TTTGTGTACACAGTCAGCTTTGG + Exonic
1038436736 8:27541629-27541651 GATCTGTCCACAACCAGCTCTGG - Intronic
1038479286 8:27890719-27890741 ACTGTGTGCACAGCGAGCTGTGG - Intronic
1039429075 8:37511625-37511647 GCAGTGTCCACGGGCAGCCTGGG + Intergenic
1040598303 8:48861076-48861098 GCTCTGTCCACACCGAGTTTTGG + Intergenic
1041824711 8:62081265-62081287 GTTATGTACACAGGCAGCTTTGG - Intergenic
1043444121 8:80302558-80302580 GCTGAGTCCTCAGCCAGCTGTGG + Intergenic
1045042611 8:98240876-98240898 GCTCTGTCCAGAACCAGCTATGG + Intronic
1045888345 8:107125974-107125996 GCAATGCCCACAGCCAGCATTGG + Intergenic
1048299637 8:133241944-133241966 GCTCTGTCCTGAGCCAGGTTTGG - Intronic
1048877395 8:138847595-138847617 CCTTTATCCACAGCAAGCTTTGG - Intronic
1048988234 8:139746798-139746820 GCTGTGCCCACGGCCACATTGGG + Intronic
1049433215 8:142574808-142574830 GCCGTGTCCACACCCTGCGTCGG + Intergenic
1049536597 8:143185513-143185535 GCTGGGTCCACACCCACCGTGGG - Intergenic
1049613710 8:143567420-143567442 GCCGCGGCCACAGCCGGCTTGGG + Exonic
1049666911 8:143849004-143849026 GCTGTGTCCACAGGCCACTGTGG + Intergenic
1050115642 9:2260665-2260687 GCTGTGGCTACAGGCAGCTGAGG - Intergenic
1050800061 9:9599461-9599483 GCTGTATCCACACCCAGCCCAGG - Intronic
1054784270 9:69195740-69195762 GCTGTTTGAACAGTCAGCTTTGG - Intronic
1056752415 9:89362268-89362290 GCTGTGTTCAGAGCAGGCTTGGG + Intronic
1057664191 9:97031273-97031295 CCTATGTCCACAGCCATCTCTGG - Exonic
1059654420 9:116344577-116344599 GCATTCTCCACAGCCAGCTCTGG - Exonic
1060946138 9:127569988-127570010 ACTGTCTCCCCTGCCAGCTTGGG - Intronic
1061487540 9:130927999-130928021 GCTGTGCCTACAGGCAGCCTGGG - Intronic
1061874334 9:133536346-133536368 GCTGTGGAGACAGCCAGCCTCGG - Intronic
1062220759 9:135413836-135413858 CCTCTGTCCACACCCAGCTGAGG + Intergenic
1190582671 X:51903743-51903765 GCTGTGTCCACAGCCAGCTTGGG + Intergenic
1190929159 X:54933778-54933800 GCTGTGTCCACAGCCAGCTTGGG + Intronic
1195309502 X:103616953-103616975 GTTGTGCCCACAGTCACCTTTGG - Intronic
1201864768 Y:18637928-18637950 GCAGTTTCCTCAGTCAGCTTTGG + Intergenic
1201868554 Y:18682450-18682472 GCAGTTTCCTCAGTCAGCTTTGG - Intergenic