ID: 1190932844

View in Genome Browser
Species Human (GRCh38)
Location X:54964173-54964195
Sequence AAAATGTGCTAAGCCCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190932841_1190932844 -8 Left 1190932841 X:54964158-54964180 CCCAGGAGGGGCAGGAAAATGTG 0: 1
1: 0
2: 3
3: 31
4: 328
Right 1190932844 X:54964173-54964195 AAAATGTGCTAAGCCCACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1190932840_1190932844 -3 Left 1190932840 X:54964153-54964175 CCTAACCCAGGAGGGGCAGGAAA 0: 1
1: 0
2: 0
3: 35
4: 317
Right 1190932844 X:54964173-54964195 AAAATGTGCTAAGCCCACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1190932842_1190932844 -9 Left 1190932842 X:54964159-54964181 CCAGGAGGGGCAGGAAAATGTGC 0: 1
1: 0
2: 3
3: 13
4: 208
Right 1190932844 X:54964173-54964195 AAAATGTGCTAAGCCCACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190932844 Original CRISPR AAAATGTGCTAAGCCCACTT GGG Intronic
900201585 1:1409959-1409981 AACATGTGCTACGTCCACTCAGG + Intergenic
901271262 1:7953821-7953843 AAAATCTGCAAAGCCCAGTGTGG - Intergenic
903084837 1:20846691-20846713 AAAATGTGGCTAGCACACTTAGG + Intronic
906376221 1:45298942-45298964 AAAATCTGCCAAGGCCACCTTGG - Intronic
906581149 1:46936119-46936141 AAAATGTGCTGGGCACAGTTGGG + Intronic
906602575 1:47142757-47142779 AAAATGTGCTGGGCACAGTTGGG - Intronic
907175590 1:52519243-52519265 AAAATATGCTAAGCCAAATAAGG + Intronic
907714115 1:56911925-56911947 AATAACTTCTAAGCCCACTTGGG + Intronic
909786059 1:79615318-79615340 AAAAAGTGCTAAGCCATTTTGGG - Intergenic
910698694 1:90049221-90049243 AAAATATGGTAAGACCACCTGGG - Intergenic
912201934 1:107468198-107468220 AATATGGTCTAAGCCCTCTTAGG - Intronic
912225397 1:107727708-107727730 TAAATGTGCAAAGCCCACAAAGG - Intronic
913350577 1:117854341-117854363 CAAATCTGCTAAGCCAACTCTGG + Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
920292685 1:204935071-204935093 AAAATGCTCTAAGAGCACTTAGG + Intronic
920795157 1:209129926-209129948 AACATGTGCTGTGCCCACTCAGG + Intergenic
921109191 1:212015428-212015450 AACATGTGCTATGTCCACTCAGG + Intronic
923283346 1:232466169-232466191 AACGTGGGCTAAACCCACTTTGG - Intronic
923868009 1:237961191-237961213 AAACTGTGCTCTGACCACTTTGG - Intergenic
1063048408 10:2417667-2417689 ACATTTTGCTAAGCACACTTTGG - Intergenic
1064027136 10:11857791-11857813 AAACTGTGCCGCGCCCACTTCGG + Intronic
1065810797 10:29441527-29441549 AAACTGTGCTCTGACCACTTGGG - Intergenic
1067119055 10:43458226-43458248 AAAGTGTGCTCTGCCCACATTGG - Intronic
1069424912 10:68279986-68280008 AACATGTGCTGTGTCCACTTAGG + Intergenic
1070966871 10:80535285-80535307 AACATGTGCTATGTCCACTCAGG + Intergenic
1071274104 10:84037159-84037181 AAAATGAGGTGAGCCCACCTTGG + Intergenic
1073492081 10:103859395-103859417 TAAAAGTGCTAAAACCACTTTGG - Intergenic
1076187888 10:128463148-128463170 AAGAAGTGCTCAGCTCACTTTGG - Intergenic
1079322428 11:19462478-19462500 AAACTATGCTATGCCCACTTTGG + Intronic
1082172376 11:49021181-49021203 AGAAAGTCCTAAGCCTACTTAGG + Intergenic
1089727397 11:120494375-120494397 ACAATGTGCTAATACTACTTGGG + Intergenic
1091913270 12:4249282-4249304 GAAATGTGAGAAGCCCATTTGGG - Intergenic
1092403298 12:8196218-8196240 AAAATACGCTAAGCCCACTAAGG - Intergenic
1094474095 12:30828019-30828041 AAAATCTGCCCAGCCCACTTTGG + Intergenic
1097255110 12:57667564-57667586 AAACTGTGCTCTGACCACTTTGG + Intergenic
1099465586 12:82983054-82983076 GCAATGTGTTAAGGCCACTTAGG + Intronic
1100059468 12:90556091-90556113 AGAAAGTGCTAAGCCCAGATGGG - Intergenic
1100670095 12:96802407-96802429 AAACTATCCTAAGCACACTTAGG + Intronic
1105295930 13:19087929-19087951 AAAAAAGGCTAGGCCCACTTAGG + Intergenic
1107241938 13:38246315-38246337 AAAATATTCTAAGACTACTTAGG - Intergenic
1108209988 13:48128453-48128475 ACATTGTGCTAAGCCCTCTACGG + Intergenic
1109670383 13:65599067-65599089 AAAATATGCTAAGGCTTCTTAGG + Intergenic
1110210429 13:72965947-72965969 AAAATTTGCTATGACCAGTTTGG + Intronic
1110321484 13:74165271-74165293 AAAATATGAAAAGCCCACTGAGG - Intergenic
1111231477 13:85349513-85349535 AAAATATGCTAAGTCACCTTGGG - Intergenic
1115313448 14:32002916-32002938 TAAATGTGTTAAGCCCTCATGGG + Intergenic
1117411577 14:55455978-55456000 AACATGTGCTGAGTCCACTCAGG - Intronic
1120593743 14:86407867-86407889 AAACTGTGCTCAGACCACCTTGG - Intergenic
1126571723 15:50158826-50158848 AACATGTGCTGTGCCCACTCAGG + Intronic
1128237105 15:66075754-66075776 AGAATGAGCTAAGCCACCTTGGG + Intronic
1129821316 15:78603929-78603951 AACATGGGCTGAGTCCACTTGGG - Intronic
1134507929 16:14823172-14823194 AAAATGTGCCAAGTACTCTTTGG + Intronic
1134976198 16:18572751-18572773 AAAATGTGCCAAGCACTCTTTGG - Intergenic
1139162210 16:64524253-64524275 AAAATGTGCTAAGCACTTTAAGG + Intergenic
1139355051 16:66362663-66362685 AAACTGGGCTAGGCTCACTTTGG - Intergenic
1140874855 16:79141346-79141368 AAACTGTGCTCTGACCACTTTGG + Intronic
1141862246 16:86725783-86725805 ATAATGTGCACAGCCCTCTTTGG + Intergenic
1143605505 17:7982703-7982725 AAAATGGCCTAAGCCCACAAAGG + Intergenic
1145837810 17:27967950-27967972 AAAATGTGCTAACCACACTTTGG - Intergenic
1148435828 17:47684219-47684241 AAACTGAGCCAATCCCACTTAGG - Exonic
1148512327 17:48182095-48182117 AAAATCAGCTCAGCCCAATTCGG - Intronic
1151438122 17:74110876-74110898 AAAATGTTATCAGCCCACTTTGG - Intergenic
1153394786 18:4606576-4606598 AATCTGTGCTAAGCACAATTGGG - Intergenic
1153745231 18:8171846-8171868 TAAATGTGCTCAGAACACTTAGG + Intronic
1157745549 18:50132048-50132070 ATATTTTGCTAAGCCCACTGTGG - Intronic
1157882129 18:51330389-51330411 AAAATGTGGTGAGCTCACTGTGG + Intergenic
1159613224 18:70549449-70549471 GAAATGTTTTAAGACCACTTGGG - Intergenic
1162279115 19:9680646-9680668 AACATGTGCTATGTCCACTCAGG + Intergenic
1163225676 19:15959457-15959479 AAAATGTCCAAAGTCCCCTTTGG + Intergenic
1164231089 19:23289641-23289663 AACATGTGCTATGTCCACTCAGG - Intergenic
927839773 2:26432684-26432706 AAAATGTCCCTAGGCCACTTTGG + Intronic
928496605 2:31839387-31839409 AGAATCTGAGAAGCCCACTTGGG - Intergenic
928614518 2:33023848-33023870 CACATGTGATAGGCCCACTTTGG + Intronic
932367437 2:71161801-71161823 AACATGTGCTATGTCCACTCAGG + Intergenic
932396000 2:71448481-71448503 AAGATGAGATAACCCCACTTTGG + Intergenic
932710524 2:74060797-74060819 AACATGTGCTATGTCCACTCAGG - Intronic
935152778 2:100453022-100453044 AAACTGTGCTCTGACCACTTTGG + Intergenic
935958094 2:108398724-108398746 AAACTGTGCTCAGACCACCTTGG - Intergenic
938142454 2:128807631-128807653 AAAATGAGCAAAGCCCAAATAGG - Intergenic
939002903 2:136756741-136756763 ACAATGGGCTATGCCAACTTGGG + Intergenic
939578313 2:143921580-143921602 AACATGTGCTGTGCCCACTCAGG - Intergenic
939584898 2:143992256-143992278 AACATGTGCTGTGCCCACTCAGG + Intronic
944608835 2:201379527-201379549 AAAATATGCATAGCGCACTTTGG + Exonic
1169991820 20:11513082-11513104 AACATGTGCTATGTCCACTCAGG - Intergenic
1170019103 20:11816023-11816045 TAAATGTAGTAAGCCCATTTTGG - Intergenic
1170849893 20:19995410-19995432 AAAATATGCTGTGCCCAATTAGG + Intronic
1172721414 20:37001482-37001504 AACATGTGCTATGTCCACTCAGG + Intronic
1172736112 20:37126856-37126878 AACATGTGCTTAGTCCACTCAGG + Intronic
1175172283 20:57089272-57089294 AAGATTTGATAAGCCCAGTTAGG + Intergenic
1175646079 20:60673001-60673023 AAAATGTGCTCCGACCACCTTGG - Intergenic
1182343457 22:29643563-29643585 AACATGTGCTATGTCCACTCAGG - Intronic
950228476 3:11255590-11255612 AAACTGTGCTCTGACCACTTTGG - Intronic
950253513 3:11487107-11487129 AACATGTGCTGTGCCCACTCAGG - Intronic
952019033 3:28994800-28994822 AAAATGTTCTAGGCCAAGTTGGG - Intergenic
952386235 3:32843481-32843503 TAAATGTGCTAAGCACAACTGGG - Intronic
955714791 3:61817724-61817746 AAAGTGTGCTGGGCCTACTTGGG + Intronic
959112787 3:102142119-102142141 AAAATGTGATGAGCACACCTCGG - Intronic
959947115 3:112136948-112136970 AAAATGTGCTGAGGCCACTGAGG - Intergenic
966818885 3:183909626-183909648 AAAATATGTAAAGCCCACGTAGG - Intergenic
969762768 4:9201642-9201664 AAAGTACGCTAAGCCCACTAAGG + Intergenic
971773325 4:30927578-30927600 AACATGTGCTGTGCCCACTCAGG + Intronic
972654273 4:41049839-41049861 AACATGTGCTATGTCCACTCAGG + Intronic
974077717 4:57182814-57182836 TAAATGTGATAATCTCACTTGGG + Intergenic
977006884 4:91578676-91578698 AAAATGTGCTTAATACACTTTGG + Intronic
977354910 4:95933323-95933345 AAAATGTGCTCTGACCACCTTGG + Intergenic
978963299 4:114710330-114710352 GAAATGAGCTAAACTCACTTGGG - Intergenic
979135602 4:117108583-117108605 AAAATGTCCTAAGCAATCTTTGG - Intergenic
982597081 4:157399942-157399964 AAAATGTGCTAAGAGAAATTAGG - Intergenic
982902519 4:161025134-161025156 AGAACCTGCTAATCCCACTTTGG + Intergenic
982993898 4:162316856-162316878 AAAATGTGCTAAGGTCTCTGTGG + Intergenic
986881157 5:12173343-12173365 CAAATGTGATGTGCCCACTTGGG - Intergenic
990039832 5:51365622-51365644 AAAATCTCCCCAGCCCACTTTGG - Intergenic
990485722 5:56257959-56257981 AACATGTGCTATGTCCACTAAGG - Intergenic
991015998 5:61933268-61933290 AATATGTGCTTTGGCCACTTGGG + Intergenic
991652711 5:68872503-68872525 AAAATGTTCAAAGCCCTCTCTGG + Intergenic
992201608 5:74389977-74389999 AAACTGTCCCAAGCCCACTGGGG + Intergenic
992655663 5:78907238-78907260 AAAAGGTACAAAGCCAACTTTGG - Intronic
993689406 5:90981090-90981112 AAACTGTGCTCTGACCACTTTGG - Intronic
994025100 5:95073003-95073025 AATAGTTGCTAAGCGCACTTTGG - Intronic
998431541 5:142074937-142074959 AACATGTGCTATGTCCACTCAGG - Intergenic
999331301 5:150675167-150675189 AAAATGTTCTGAGCCCATTCAGG - Intronic
999411216 5:151351413-151351435 AATATGTGATTAGGCCACTTAGG - Intergenic
999862454 5:155663149-155663171 TGAATGTGCCAAGCACACTTTGG - Intergenic
1001264320 5:170261670-170261692 AAAGTGTACCAAGCCCCCTTTGG - Intronic
1002590479 5:180288095-180288117 AAGAAGTGCACAGCCCACTTAGG + Intronic
1005158463 6:22834917-22834939 AAGATTTCCTAAGCACACTTTGG + Intergenic
1008000173 6:46352103-46352125 AGAATGTCCTTAGCCCACTGGGG - Intronic
1009217955 6:60945386-60945408 AACATGTGCTGAGTCCACTAAGG + Intergenic
1010237500 6:73587721-73587743 AACATGTGCTTAGTTCACTTAGG - Intergenic
1012541578 6:100367710-100367732 AAAATCTGCTAAGCTAATTTGGG - Intergenic
1013674760 6:112446009-112446031 AAAATGTATTAAGACCACTGAGG - Intergenic
1015107507 6:129554047-129554069 AATATGTGAAAAGACCACTTGGG + Intergenic
1016290502 6:142523633-142523655 AAAATATGCTAAGCCCTCTGTGG - Intergenic
1016667479 6:146658734-146658756 AAAATGTATTGAGCCCACTTTGG + Intronic
1019823658 7:3265741-3265763 GAAATGTCCTTAGGCCACTTTGG + Intergenic
1022490502 7:30813776-30813798 AAAATTTGCAAAGCTAACTTGGG + Intronic
1023007861 7:35893355-35893377 ACAAAGTGCTAATCACACTTTGG + Intronic
1023015144 7:35960900-35960922 ACAAAGTGCTAATCACACTTTGG + Intergenic
1024065802 7:45733794-45733816 ACAAAGTGCTAATCACACTTTGG - Intergenic
1025216991 7:57065263-57065285 ACAAAGTGCTAATCACACTTTGG - Intergenic
1025627879 7:63238625-63238647 ACAAAGTGCTAATCACACTTTGG - Intergenic
1025654394 7:63505479-63505501 ACAAAGTGCTAATCACACTTTGG + Intergenic
1029116899 7:98242190-98242212 AATAACTGCTAAGCCCACTGGGG + Intronic
1029362867 7:100100223-100100245 AAAAAGAGTTATGCCCACTTTGG - Intronic
1031365770 7:120899059-120899081 AAAATGTTCTTAGCCTAATTGGG + Intergenic
1031847593 7:126824985-126825007 AAAATTTGGGAAGGCCACTTGGG + Intronic
1036843759 8:12147436-12147458 AAAATACGCTAAGCCCACTAAGG - Intergenic
1036865131 8:12389754-12389776 AAAATACACTAAGCCCACTAAGG - Intergenic
1037921048 8:22805857-22805879 AGCATGTGCTTAGCCCATTTAGG - Intronic
1039136097 8:34324135-34324157 AAAAAGTGCCTAGCCCATTTTGG - Intergenic
1042127717 8:65555494-65555516 AAAATGTACAAGGCACACTTGGG + Intergenic
1042476340 8:69252733-69252755 AAAAAGTACTAAGCTCATTTGGG - Intergenic
1043312714 8:78881312-78881334 GAAGTGTGCTAAGCCAAGTTGGG + Intergenic
1047977108 8:130141578-130141600 AAAATGTGCTTGGCACACATCGG + Intronic
1051360999 9:16281568-16281590 AAACTGTACAAAGCCCTCTTTGG - Intergenic
1052356586 9:27511096-27511118 AAAATGAGTTAAACACACTTGGG - Intronic
1055199271 9:73638943-73638965 GAATTGTGCTAAGCCCAGTGAGG + Intergenic
1055285964 9:74728020-74728042 AAAATGTGATAAAACAACTTGGG - Intronic
1055704099 9:78978947-78978969 AAAATGTGAGAAGCATACTTTGG - Intergenic
1056624602 9:88244365-88244387 AACATGTGCTATGTCCACTCAGG - Intergenic
1056814884 9:89793864-89793886 AAAATGTAAAAAGCCCATTTTGG - Intergenic
1059429095 9:114239514-114239536 AAATTGTGCAAAGACCACTGTGG + Intronic
1061427026 9:130506165-130506187 AACATGTGCTGTGTCCACTTAGG - Intergenic
1185689091 X:2138509-2138531 AAATTGTTATAAGGCCACTTAGG - Intergenic
1186050387 X:5586812-5586834 AAAATGTTATAAGTCCATTTTGG + Intergenic
1186187713 X:7038290-7038312 AATATGTGCTATGCTCACCTGGG - Intergenic
1190932844 X:54964173-54964195 AAAATGTGCTAAGCCCACTTGGG + Intronic
1191068820 X:56379748-56379770 AACATGTGCTGTGCCCACTCAGG - Intergenic
1192761461 X:74099072-74099094 AACATGTGCTATGTCCACTCAGG + Intergenic
1198578310 X:138035616-138035638 AAAATGTGCTAGGCCCCACTGGG + Intergenic
1199109820 X:143918001-143918023 AATATGTGATATGCCTACTTAGG - Intergenic