ID: 1190933014

View in Genome Browser
Species Human (GRCh38)
Location X:54966377-54966399
Sequence CAGGCTCAGGATACTGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190933014 Original CRISPR CAGGCTCAGGATACTGAATG GGG (reversed) Intronic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
900719637 1:4166947-4166969 CAGGCTCAGCATACTCGGTGCGG - Intergenic
902511127 1:16967579-16967601 CAGGCTCAGGATAGGGGCTGGGG + Intronic
902788996 1:18752267-18752289 CAGGCCCAAGAGAATGAATGTGG - Intergenic
904171719 1:28595998-28596020 CAGTCTCATGTTACTGACTGAGG - Intronic
904212716 1:28896675-28896697 CAGGCTCAAGACAATGAGTGAGG + Intronic
912245170 1:107954511-107954533 TTGCCTCAGGATACTGAATCTGG - Intronic
920039366 1:203085664-203085686 CAGGCTCAAGAAGGTGAATGAGG - Exonic
920788018 1:209061425-209061447 AAGGCTCAGGATACCCAATATGG - Intergenic
922461233 1:225815777-225815799 CAGGCTCAGGTTCCTCCATGAGG + Intronic
924664627 1:246058463-246058485 CTGCTTCAGGTTACTGAATGGGG - Intronic
924862107 1:247935987-247936009 CAGACGCAGGACACTGCATGAGG - Intergenic
1063644333 10:7864025-7864047 CTGGCTTAGGATACTGACAGTGG - Intronic
1070507360 10:77125851-77125873 TAGTCTCAGAATTCTGAATGTGG - Intronic
1070767680 10:79066145-79066167 CAGGCCCTGGATACTTATTGAGG + Intergenic
1071456797 10:85857365-85857387 CAGGCTCAGCCTCCTGAGTGTGG + Intronic
1072831654 10:98664312-98664334 CACTCTCAGAACACTGAATGGGG + Intronic
1074433661 10:113415324-113415346 CAGGCTGATATTACTGAATGTGG + Intergenic
1074509548 10:114100074-114100096 CTGGCTCAGAACACAGAATGTGG - Intergenic
1076060606 10:127411349-127411371 CAGGTGCTGGATACTGAATGAGG - Intronic
1080128279 11:28763779-28763801 CATGCTCAGTATACTCATTGTGG - Intergenic
1080511446 11:32977034-32977056 CATGTTCAGGAAACTGGATGTGG + Exonic
1082072105 11:47947478-47947500 CAGGCCCAGGATAATGCGTGTGG - Intergenic
1083608181 11:63991499-63991521 CAGGCACAGCATACAGAATGCGG - Intronic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083714324 11:64567133-64567155 CAGGCTCTCCATCCTGAATGTGG + Intronic
1085870809 11:80347204-80347226 CAGGCACAGGATACGGGGTGGGG + Intergenic
1087191227 11:95256699-95256721 CAGGATGGAGATACTGAATGCGG + Intergenic
1090468651 11:126958448-126958470 CAGTCTCAGGATCTTGAATGTGG - Intronic
1093008953 12:14083705-14083727 AAGGCTCAGGATACAAAATCAGG + Intergenic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1093488376 12:19677759-19677781 CAGCCACATAATACTGAATGGGG - Intronic
1097056348 12:56252124-56252146 CAGGCTCAGGGAGGTGAATGGGG + Intronic
1097695596 12:62772367-62772389 ATGGCTCAGGACACAGAATGGGG - Intronic
1101368620 12:104102023-104102045 CAGGCACAGGATACAGATTCAGG + Exonic
1102296560 12:111741425-111741447 CAGGCTGAGGACACTCAGTGTGG - Intronic
1105719052 13:23095852-23095874 CATGGTCAGGAAACTGCATGTGG + Intergenic
1109600023 13:64613265-64613287 CAGGGACAGGAAACAGAATGTGG - Intergenic
1111264533 13:85791222-85791244 AACGCTGAGGATACTGAAAGAGG + Intergenic
1111965147 13:94853723-94853745 CAAGCTGAGAATTCTGAATGTGG + Intergenic
1112508353 13:99988902-99988924 CAGGCCCAGGCTCCTGAGTGTGG - Intergenic
1113524855 13:110966841-110966863 AAGACTGAGGACACTGAATGGGG - Intergenic
1114500581 14:23165424-23165446 CAGCCTCAGGAACCTGAAGGAGG + Exonic
1117021833 14:51578904-51578926 CAGGCTTAGGAATATGAATGTGG + Intronic
1119053244 14:71391403-71391425 TAGACTAAGAATACTGAATGCGG - Intronic
1120968785 14:90190696-90190718 CAGACTGATGATGCTGAATGAGG - Intergenic
1128728297 15:70004118-70004140 CAGGCTCCAGATAGTGACTGGGG - Intergenic
1129290013 15:74558247-74558269 GACGCACAGGAGACTGAATGAGG - Intronic
1133097537 16:3457868-3457890 CAGGCCCAGGATCCCGTATGCGG - Intronic
1134806972 16:17134403-17134425 GAGGCTCAGGGTACAGAGTGGGG - Intronic
1136370914 16:29835560-29835582 CAGGCTCAAGTTCCTGACTGCGG - Intronic
1139063803 16:63288821-63288843 CAGGCTCAGCTTACTGAAACTGG - Intergenic
1139367998 16:66445626-66445648 CAGGCAGAGGATTCTGAATCAGG + Intronic
1139589721 16:67926907-67926929 CAGGATCAGGCTACTTAAAGGGG - Intronic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1141867979 16:86763776-86763798 CTGACTGAGAATACTGAATGGGG - Intergenic
1142971754 17:3616523-3616545 GAGGGTCAGGATTCTGAGTGGGG - Intronic
1143709972 17:8727393-8727415 CAGGGGCAGGAGACTGAAGGAGG - Intergenic
1144029026 17:11303618-11303640 CAGGCTCAGCCTTCTGCATGTGG - Intronic
1145990030 17:29073769-29073791 CGGGCTCAGGACACAGAGTGAGG + Exonic
1146509700 17:33436259-33436281 CAGGCTTAGGATTCTGAATTAGG + Intronic
1146745542 17:35325510-35325532 CATGGCCAGCATACTGAATGGGG + Intergenic
1150225193 17:63520876-63520898 CAGGCTGAGGATAATGAACTAGG - Intronic
1150294344 17:63999652-63999674 CAGAGTCAGGAGACAGAATGGGG + Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1156364657 18:36414716-36414738 CAGGCTCAGCCCACAGAATGTGG - Intronic
1159115443 18:64107908-64107930 CAGGCTCAGGCCATTGAAGGTGG + Intergenic
1160478774 18:79219027-79219049 CAGGATAAGAATAATGAATGAGG + Intronic
1160714969 19:572418-572440 CAGGCTCACGCTACGGAATCCGG - Intronic
1160893195 19:1390309-1390331 CAGGGTCAGGCTACAGAGTGAGG - Intronic
1162700403 19:12510888-12510910 CTTGCTCAGGCTACTGAAGGTGG - Intronic
1162875192 19:13616251-13616273 CAGCCCCAGGACACTGAGTGAGG + Intronic
1164015643 19:21254007-21254029 CAGACCCAGGATACTGCATATGG + Intronic
1166574619 19:43826121-43826143 CAGACCCACGATACTGGATGAGG + Intronic
1166719669 19:44989870-44989892 CATGCTCAGGAAACTGAAAAGGG - Intronic
1167448813 19:49555581-49555603 CGGGCTAAGCATATTGAATGTGG - Intergenic
1167645431 19:50702908-50702930 CAGCCTCAGGAAGCTGAATCAGG - Intronic
1167749441 19:51370971-51370993 TAGGGTCAGGATATAGAATGTGG - Intergenic
1168453920 19:56489933-56489955 CAAACTCAGGAAACTGCATGAGG - Intergenic
925234954 2:2269990-2270012 CAGGCTCAAGATACGAATTGTGG - Intronic
925772333 2:7295185-7295207 CAGTCTCAGGAGTCTGAAAGGGG + Intergenic
926992063 2:18690581-18690603 CTGGCTGAGGATGCAGAATGGGG - Intergenic
927670946 2:25068479-25068501 CAGGATGAGCATAATGAATGAGG - Intronic
929791586 2:45027149-45027171 CAGCCTCAGGCTACTTGATGTGG - Intergenic
930684976 2:54298619-54298641 AAGGCTCAGGCTACTGGAAGTGG + Intronic
934272612 2:91548245-91548267 CAGGCTCAGGAGGCCGCATGAGG + Intergenic
938259420 2:129884480-129884502 CAGTCTCAGGATGGTGGATGGGG + Intergenic
946606446 2:221410598-221410620 CTGACTCAGGATCCTGAAGGAGG + Intergenic
948735170 2:239998980-239999002 CAGGCTCAGGATGCTGCACCAGG + Intronic
948739303 2:240032565-240032587 CAGCCTCAGGTGGCTGAATGGGG - Intergenic
948968974 2:241409107-241409129 GAGACCCAGGATCCTGAATGAGG - Intronic
1172446225 20:34994837-34994859 CAGGCTCAGGCTAGTGCAGGAGG + Intronic
1177539676 21:22476264-22476286 CAAGCACAGAAAACTGAATGTGG - Intergenic
1180983068 22:19888425-19888447 GAGGCGCATGATACTGCATGCGG - Intronic
1184379886 22:44138603-44138625 CTGCCTTAGGAAACTGAATGTGG - Intronic
949299242 3:2564310-2564332 AAGGCTGTGGATAGTGAATGTGG + Intronic
951157147 3:19369535-19369557 CAGGCTCAAGATACTGTTTTGGG - Intronic
951910255 3:27742980-27743002 CAGTCTCAGAAGACTGAATTGGG + Intergenic
959681662 3:109103473-109103495 CAGGCACAGGAAACTGCCTGGGG + Intronic
962007000 3:131359832-131359854 CTGCCTCAGGATAGTGAATGGGG + Intergenic
964262781 3:154858518-154858540 GAGGCTCAGGATAGGGAGTGGGG - Intergenic
964634796 3:158847219-158847241 TAGGCTCAGGACTCTGAAAGGGG + Intergenic
965899608 3:173622428-173622450 GAGGCTGAGAATACAGAATGTGG + Intronic
966038528 3:175450247-175450269 CATGAAAAGGATACTGAATGAGG + Intronic
966269192 3:178084151-178084173 CACACTCAGGAAACTGAATTAGG + Intergenic
969365043 4:6689506-6689528 CAGGAGCAGGAAACTGAAGGAGG - Intergenic
970158018 4:13160900-13160922 GAGGCACAGAATCCTGAATGGGG + Intergenic
970428780 4:15969349-15969371 CAGCATCAGGATACTCAAAGTGG - Exonic
971531333 4:27692858-27692880 GAGGCTCAGGCTACTGATTCAGG + Intergenic
974965878 4:68760213-68760235 AAGGCTGAGAACACTGAATGGGG - Intergenic
975000436 4:69219042-69219064 AAGGCTGAGGACGCTGAATGGGG - Intergenic
975013750 4:69385151-69385173 AAGGCTGAGGACAGTGAATGGGG + Intronic
975579413 4:75893195-75893217 CATGTTCAGAATAGTGAATGAGG + Intronic
978477591 4:109148522-109148544 CAGACTCAGGAGACTAAACGTGG - Intronic
982713961 4:158787260-158787282 GAGGCTTAGGATACTGAAGTTGG + Intronic
983218597 4:165023241-165023263 CCATCTAAGGATACTGAATGGGG + Intergenic
985770141 5:1804512-1804534 GACACTCAGGATGCTGAATGGGG - Intronic
986373776 5:7109305-7109327 CAGGCTCAGTGTACTGAATTAGG + Intergenic
991693112 5:69244793-69244815 CATGGTCAGTATACAGAATGGGG - Intronic
991941663 5:71859273-71859295 GAGGCTCAGGATCCTAACTGTGG - Intergenic
993207666 5:84904867-84904889 CAGGCTAATGAGACTGAATGAGG + Intergenic
994872874 5:105376196-105376218 CAGGCTCTCAAGACTGAATGAGG - Intergenic
995318592 5:110804626-110804648 GAGGGTCAGGATTCTGAGTGTGG - Intergenic
996096976 5:119409293-119409315 CAGGCACATGGTACTAAATGAGG - Intergenic
997620664 5:135290529-135290551 CAGGGTCAGGAATCTGAGTGTGG - Intronic
998678218 5:144434408-144434430 CAGTATGAGGATCCTGAATGAGG + Intronic
999189423 5:149735544-149735566 AAGGCTCAGAAAACTGCATGGGG - Intronic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1001426382 5:171625390-171625412 CAGGTTCCGGATAGTGGATGTGG - Intergenic
1001776747 5:174334590-174334612 CAGGGGCAGGATACTGATTCTGG + Intergenic
1004879817 6:19996327-19996349 CAGGTTCAGAATCCAGAATGGGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006474889 6:34247314-34247336 CAGCCTCAGGTTACTCACTGGGG - Intronic
1007162906 6:39806869-39806891 CATGCTCATCATACTGGATGTGG + Intronic
1013179906 6:107708797-107708819 AAGGCTCAGGACAGTGAAGGAGG + Intronic
1013746849 6:113355912-113355934 CAGGCTTAGGATCCTGAAAAAGG + Intergenic
1019133666 6:169895145-169895167 CATGCTCAGAAGACAGAATGAGG + Intergenic
1019405189 7:879514-879536 CGGGCTCAGGACAGTGCATGTGG + Intronic
1020748018 7:12102299-12102321 CAGCCTCAGGAGACTGAAGTGGG + Intergenic
1030850598 7:114480945-114480967 CGAGCTCTGGATAATGAATGTGG + Intronic
1032259219 7:130321467-130321489 CTGGCTCAGGATCCTTCATGAGG + Intronic
1043034495 8:75179038-75179060 GTGGCTCAGGCTACTGAATCAGG - Intergenic
1043351604 8:79367777-79367799 CAAGCTCAGGAAACAGCATGTGG + Intergenic
1043542089 8:81275562-81275584 TGGCCTCAGGATTCTGAATGTGG - Intergenic
1046852568 8:118991711-118991733 CAGACTCAGGATACTGAATTGGG - Intergenic
1049546751 8:143235607-143235629 CGGGCTCAGGGTACTTCATGGGG + Intergenic
1050829680 9:9995529-9995551 CAATCTCAGGATACAGAGTGGGG - Intronic
1052792243 9:32886468-32886490 GAGGCTCAGCATCCTGAATGAGG + Intergenic
1053052983 9:34976896-34976918 CAGGCTGAGGAAACTGCGTGAGG + Intronic
1058911549 9:109524491-109524513 TAGGCTCATGATTCTGAGTGTGG - Intergenic
1058951383 9:109906971-109906993 CAGGCTCAAGTGAGTGAATGAGG - Intronic
1060559398 9:124530300-124530322 CAGGCTGTGGAGACTGAGTGGGG - Intronic
1061144868 9:128791714-128791736 GAGACCCAGGATACAGAATGTGG + Intronic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061941976 9:133888712-133888734 CAGGCTCATGATACTAATTGGGG - Intronic
1186495590 X:10010656-10010678 CAGGCTCAGGAGTTGGAATGGGG - Intergenic
1186901977 X:14066247-14066269 CAGGCACAGGGTAATGAATAAGG - Intergenic
1187386373 X:18852340-18852362 TGGGCTCAGGTCACTGAATGGGG + Intergenic
1190933014 X:54966377-54966399 CAGGCTCAGGATACTGAATGGGG - Intronic
1192576430 X:72246687-72246709 CAGGCAGAGGAAACTGCATGTGG - Intronic
1193425208 X:81333944-81333966 CAGGCTCTGACTACTGAATCAGG - Intergenic
1198478476 X:137018386-137018408 CAACCACAGGATCCTGAATGAGG - Intergenic
1198991206 X:142516512-142516534 CAGGGTGAGGAGACTGAAGGTGG - Intergenic
1200017642 X:153178989-153179011 CATGCTCAGGATTCTCAAGGAGG + Intergenic
1200146906 X:153931052-153931074 CAGGCTAAGGACACAGAACGGGG - Intronic