ID: 1190934138

View in Genome Browser
Species Human (GRCh38)
Location X:54979511-54979533
Sequence GATTTAAAACAAATAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1021
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 933}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190934137_1190934138 -10 Left 1190934137 X:54979498-54979520 CCTAAAAATAATGGATTTAAAAC 0: 1
1: 0
2: 4
3: 60
4: 761
Right 1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG 0: 1
1: 0
2: 5
3: 82
4: 933
1190934134_1190934138 8 Left 1190934134 X:54979480-54979502 CCTTCCAAATACAAAACACCTAA 0: 1
1: 0
2: 4
3: 24
4: 323
Right 1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG 0: 1
1: 0
2: 5
3: 82
4: 933
1190934135_1190934138 4 Left 1190934135 X:54979484-54979506 CCAAATACAAAACACCTAAAAAT 0: 1
1: 3
2: 10
3: 78
4: 779
Right 1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG 0: 1
1: 0
2: 5
3: 82
4: 933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190934138 Original CRISPR GATTTAAAACAAATAAAGCA TGG Intronic
901267979 1:7926925-7926947 AATTTAAAACGAATCAAGCATGG + Intronic
902742098 1:18445845-18445867 GATTTAAAAAAAAAAAAACCTGG - Intergenic
903108497 1:21107028-21107050 CATTTAAAACAAAAAAAGTATGG + Intronic
903232926 1:21932891-21932913 AATTTAAAACAAATAGAGATGGG - Intronic
903672447 1:25044863-25044885 GGTATAAGACAAATAAAGAAGGG + Intergenic
903732276 1:25505377-25505399 GAATTCAAACAAACAAAGCCCGG - Intergenic
904076363 1:27845678-27845700 GACTTAAAGCAAATAAACCAGGG + Intronic
904184531 1:28693168-28693190 GATTAAAGTCAAATAATGCACGG - Intronic
904278805 1:29403865-29403887 AATGGAAAACAAAAAAAGCAGGG - Intergenic
904933736 1:34111566-34111588 GGTTTAACAGAAATAACGCAAGG - Intronic
905118831 1:35665968-35665990 AATTAAAAATAAATAAAGCCGGG - Intergenic
906379230 1:45321543-45321565 GAATTAAAAAAAAAAAAGAAAGG - Intergenic
906457214 1:46007492-46007514 GATTTAAGAGTAATATAGCATGG - Intronic
906932406 1:50182865-50182887 AATTTAAAAAAAAAAAAGGATGG - Intronic
906993819 1:50768182-50768204 GATTAAAAAAAGATAAAGAAGGG + Intronic
907560822 1:55385906-55385928 GCTGTAGAAAAAATAAAGCATGG + Intergenic
907681170 1:56565417-56565439 CATTTAAAAAAAAAAAAGAAGGG - Intronic
907879223 1:58529364-58529386 GATGTAAAACAAAAAAATTATGG + Intronic
907911124 1:58827260-58827282 TTTTTAAAACAAATACATCATGG - Intergenic
907922402 1:58925772-58925794 GATTTAAAAAAAAAAAAAGAGGG + Intergenic
908404828 1:63804618-63804640 AATTAAAAATAAATAAAGAACGG - Intronic
908937448 1:69393262-69393284 AATGGAAAACAAAAAAAGCAGGG - Intergenic
908975850 1:69897403-69897425 GCTGTGAAAAAAATAAAGCAGGG - Intronic
909454134 1:75831107-75831129 AATGGAAAACAAAAAAAGCAGGG + Intronic
909459940 1:75899596-75899618 AATTTAAAACAAATAATTCTAGG + Exonic
909474944 1:76072228-76072250 GTTTTAAAACAAAAAAATCCTGG + Intergenic
909497091 1:76290641-76290663 GATTTAAAACAAAAAAGACCTGG - Intronic
909901225 1:81138205-81138227 GATTAAAAACAAATGAGGGAAGG + Intergenic
910154445 1:84198187-84198209 AATTTGAAACAAAGAAAGAATGG - Intronic
910820589 1:91340764-91340786 AATGGAAAACAAAAAAAGCAGGG + Intronic
911272695 1:95822809-95822831 GATGCAAAACAGAAAAAGCAGGG - Intergenic
911323836 1:96446068-96446090 GCATTAAAAAAAATAAAACAGGG + Intergenic
911676977 1:100669119-100669141 GCTTTTAAAAAAATAAAGAAGGG - Intergenic
911812251 1:102297323-102297345 TATTTAAAAAAAATAAGGAAAGG - Intergenic
912018304 1:105070822-105070844 AAATTAAAAGCAATAAAGCATGG - Intergenic
912229243 1:107773517-107773539 AATATAAAACAGATAAAGGAAGG - Intronic
912301154 1:108518496-108518518 GATTTAAAAAAAACAAAGAAGGG - Intergenic
913537541 1:119787504-119787526 GATTTAAAAAAAATACAGGCTGG - Intergenic
913591163 1:120327435-120327457 GATCTAAAAAAAATAATGCTGGG + Intergenic
913652204 1:120927664-120927686 GATCTAAAAAAAATAATGCTGGG - Intergenic
913984618 1:143553592-143553614 GATTTGGAACCAATAAAGGAGGG + Intergenic
914168905 1:145201406-145201428 GATCTAAAAAAAATAATGCTGGG + Intergenic
914524025 1:148445365-148445387 GATCTAAAAAAAATAATGCTGGG + Intergenic
914599651 1:149190509-149190531 GATCTAAAAAAAATAATGCTGGG - Intergenic
914642379 1:149621775-149621797 GATCTAAAAAAAATAATGCTGGG - Intergenic
914966541 1:152263572-152263594 AATGGAAAACAAAAAAAGCAGGG + Intergenic
916248900 1:162716650-162716672 GATCCAAAGCAAATAAAACACGG - Intronic
916641560 1:166734034-166734056 GAATTAAAACAAAACAAGGATGG + Intergenic
916994859 1:170285619-170285641 GATGAAAACCAAATAAAGCCTGG - Intergenic
917037366 1:170763452-170763474 TATTTAAAAGTTATAAAGCAAGG + Intergenic
917111569 1:171554291-171554313 AATGGAAAACAAAAAAAGCAGGG - Intronic
918285413 1:183049964-183049986 AATTTGAAAAAAATAATGCACGG - Intronic
918435284 1:184504703-184504725 GGTATAAAACAAAAAAAGCTGGG - Intronic
918436241 1:184516292-184516314 AAATTAAAACAAACAAAACAGGG + Intronic
918538287 1:185599552-185599574 GACTTAAAACAACTGCAGCAAGG + Intergenic
918916712 1:190649956-190649978 GATTTAAAAAACAGAAAGAAAGG - Intergenic
918955455 1:191201046-191201068 AATGTAAACCAAAAAAAGCAGGG + Intergenic
918992037 1:191709285-191709307 GATTTAAAAAAAGTAAATAAGGG - Intergenic
919027358 1:192193216-192193238 AATTTAAAATAAATGATGCACGG + Intergenic
919037420 1:192331969-192331991 GATGTAAAAAAAATACAACAGGG + Intronic
919282845 1:195514096-195514118 AAATTAAATGAAATAAAGCAGGG + Intergenic
919294364 1:195675882-195675904 GGTATAAAACAAATAAGGCTGGG - Intergenic
919608792 1:199719646-199719668 AATTTAAAAAAAAAAAAGAAAGG + Intergenic
919644174 1:200076484-200076506 GATTTAAAACAAATAAGATACGG - Intronic
920083597 1:203396907-203396929 GTTTAAAGGCAAATAAAGCAAGG - Intergenic
920945024 1:210520484-210520506 GATAAAAAACAAACAAAGCTTGG - Intronic
921348467 1:214211343-214211365 GATTAAAAATGTATAAAGCATGG - Intergenic
921702818 1:218286554-218286576 GGTTGAGAAAAAATAAAGCAGGG - Intronic
921756799 1:218866559-218866581 GATTCAAAAGAAATAAATAAGGG - Intergenic
922427915 1:225517051-225517073 AATTAAAAAAAAAAAAAGCATGG + Intronic
922626401 1:227049229-227049251 GAATTAAAAAAAATTAAGCAAGG + Intronic
922971553 1:229745690-229745712 GATTTAAAAAACACAAAGAAGGG - Intergenic
923255208 1:232216042-232216064 TATTTAAAAGAAATAATGAATGG + Intergenic
923510241 1:234645178-234645200 GATTTAAAATTATTAAAGGAAGG + Intergenic
923829138 1:237536197-237536219 ACTTAAAAAGAAATAAAGCAAGG - Intronic
923848843 1:237770090-237770112 GAGCTAAAACTAATAAAGAAAGG - Intronic
924103822 1:240631049-240631071 GATTAAAAACTACTGAAGCAAGG - Intergenic
924464967 1:244291445-244291467 AGTTTAAAAAAAAAAAAGCAGGG + Intergenic
1062953132 10:1520446-1520468 GTTTTAAAAAATATAAAGTATGG - Intronic
1063078613 10:2742489-2742511 TATTAAAAATAAAAAAAGCATGG - Intergenic
1063130143 10:3171335-3171357 TATTAAAAAAAAAAAAAGCAAGG + Intronic
1063546309 10:6985607-6985629 GATTTAAAACACACCAACCATGG - Intergenic
1063546963 10:6990910-6990932 GATACAAGAAAAATAAAGCAAGG + Intergenic
1064171346 10:13036329-13036351 GTTTTAAAAAATATATAGCATGG - Intronic
1065234420 10:23634309-23634331 GATTTAAAACATATAATCCAAGG + Intergenic
1065531854 10:26678484-26678506 ACTTTAAAACAAATAAAGATAGG + Intergenic
1065541271 10:26770407-26770429 TATTTAAAAAAAATAATACATGG - Intronic
1065596429 10:27317410-27317432 ACTTTAAAACAAATAAAGATAGG - Intergenic
1065936673 10:30526510-30526532 GTATCAAAACAAAGAAAGCAGGG - Intergenic
1067121267 10:43474156-43474178 GTTTCAAAAAAAAAAAAGCAGGG + Intronic
1067491949 10:46716523-46716545 AATTTAAAAAAAAAAAAGAAGGG + Intergenic
1067916818 10:50408677-50408699 CATTTAAAAAAAAAATAGCAGGG + Intronic
1067970758 10:50967813-50967835 AAATTAAAAAAAAAAAAGCAAGG + Intergenic
1067979073 10:51062151-51062173 GATTGAACAGATATAAAGCAGGG + Intronic
1068201787 10:53792329-53792351 AATTTAAAAAAAAGAAAGAAAGG - Intergenic
1068445449 10:57116297-57116319 CAATTAAAATAAATAAAACATGG + Intergenic
1068576033 10:58685690-58685712 AATGGAAAACAAAAAAAGCAGGG - Intronic
1068614595 10:59099308-59099330 TGTTAAAAACAAACAAAGCACGG - Intergenic
1068737209 10:60427669-60427691 GATTTAAAAAAATTAGAGAAGGG + Intronic
1068754289 10:60633640-60633662 GATTTTAAAAAAATAGAGCTGGG + Intronic
1068797205 10:61096712-61096734 GATTTAGAACAAATGAAGCAAGG + Intergenic
1069406143 10:68100861-68100883 GAATTAAATCAAATGAAGAAAGG - Intergenic
1069462659 10:68609986-68610008 TATTTATAAAAAATAAGGCAGGG + Intronic
1070042223 10:72792874-72792896 AATTTAAAAAAAAAAAAGAAAGG - Intronic
1070235236 10:74617889-74617911 GCTTTAAAATACATAAAGCAAGG - Intronic
1070924418 10:80208853-80208875 GTTTGAAAACAAAAAAAGAATGG - Intergenic
1071032020 10:81196200-81196222 GATTTAAAAAAAAAAAAAAAAGG - Intergenic
1071043258 10:81339902-81339924 GCTTTAAAAGAAATAAAGGTAGG + Intergenic
1071087413 10:81878687-81878709 CATTTAAAAAAAAGAAAGGACGG - Intronic
1071210231 10:83333126-83333148 GTTTTAAAACATGTTAAGCATGG + Intergenic
1071381766 10:85071867-85071889 GATTTCAAACAAATTAAAAATGG + Intergenic
1072276842 10:93831924-93831946 CATTCAAAACAATTAAACCAAGG - Intergenic
1072499668 10:96000662-96000684 GCTTTAAAAAAAATAAAGACAGG - Intronic
1072505847 10:96065791-96065813 CATTAAAAAAAAAAAAAGCAAGG + Intergenic
1072909500 10:99487281-99487303 CATTAAAAACAAATGAATCATGG + Intergenic
1074064974 10:110006553-110006575 TATTTAAAAATAATAAGGCATGG + Intronic
1074287593 10:112112796-112112818 GATTTTAAACCAATAAAGGCAGG + Intergenic
1074298609 10:112213239-112213261 GATGTAAAGAAAAAAAAGCATGG + Intronic
1074300733 10:112231394-112231416 GATTTAAAGGATATAAAGCAGGG + Intergenic
1074748203 10:116557144-116557166 AAGTTAAAATAAATAAAGAAGGG - Intronic
1075523774 10:123164926-123164948 GAATTAAAAAAAATACATCACGG - Exonic
1075806205 10:125190710-125190732 TCTTTAAAAAAAATAAAGTAAGG + Intergenic
1076557058 10:131333149-131333171 GATTTAAAAAAAAAAAAACTTGG - Intergenic
1076665847 10:132091595-132091617 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1077117961 11:893834-893856 GATTAAAAAAAAAAAAAGCTGGG + Intronic
1077581645 11:3421044-3421066 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1077943973 11:6874827-6874849 CATTTAAAACAATTCAACCAAGG - Intergenic
1078150198 11:8752145-8752167 GAATAAAAAAAAATTAAGCAAGG + Intronic
1078875217 11:15387815-15387837 GATTTAAAACATATAAATAATGG - Intergenic
1078994961 11:16687688-16687710 AATTATAAATAAATAAAGCAGGG - Intronic
1079028121 11:16965000-16965022 GATTTAAAAAAAAAAAAAAAAGG + Intronic
1079174437 11:18126011-18126033 GAAAGAAAACAAAAAAAGCAGGG - Intronic
1079217079 11:18523315-18523337 GCTTTAGAGAAAATAAAGCAGGG - Intronic
1079281015 11:19087148-19087170 GACTTAAAACAAATGATCCAAGG - Intergenic
1079420109 11:20277928-20277950 GGATTAAATGAAATAAAGCATGG - Intergenic
1079516774 11:21278567-21278589 GATTTAAATCTAACAAAACATGG + Intronic
1079662781 11:23061996-23062018 TATTAAAAGCAAATAAAGCAAGG + Intergenic
1079902668 11:26206999-26207021 GATCTAAAACAGTTAGAGCAGGG + Intergenic
1079932623 11:26584096-26584118 TATATAAAACAGATAAAGAAGGG + Intronic
1079932818 11:26586463-26586485 TATATAAAACAGATAAAGAAGGG + Intronic
1080555863 11:33416715-33416737 GATTCAAAACAAACAAGGGATGG + Intergenic
1081015473 11:37873173-37873195 GATTCAAAATGTATAAAGCATGG - Intergenic
1081043503 11:38241700-38241722 TGTTTAAAACAAAGAAAGGAAGG - Intergenic
1081081834 11:38751389-38751411 GATCAAAAGCAAATAAAACAAGG + Intergenic
1081088159 11:38826311-38826333 AATGAAAAACAAATAAAGCAGGG + Intergenic
1081116619 11:39209845-39209867 GATTGAAAACAAAAAAATTAAGG - Intergenic
1081335281 11:41857736-41857758 AAATTAAAAAAAAAAAAGCAAGG + Intergenic
1081458344 11:43247322-43247344 GAATAAAAACAAAAAAAGAAGGG + Intergenic
1081632252 11:44697481-44697503 AATTGAAAACAAATAAATGACGG + Intergenic
1081747802 11:45485232-45485254 GTTTTGAAGCAAACAAAGCAGGG + Intergenic
1081956662 11:47098340-47098362 AAATAAAAAAAAATAAAGCAGGG + Intronic
1083124705 11:60552663-60552685 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1083253720 11:61483938-61483960 GACTAAAAAAAAATAAAGCCAGG + Intronic
1084238555 11:67803866-67803888 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1084833860 11:71788967-71788989 GCTTTAAAGCCAATAAAACAGGG + Intronic
1085017023 11:73180608-73180630 TATCTAAAATATATAAAGCATGG - Intergenic
1085062047 11:73456122-73456144 GAAATAAAATATATAAAGCATGG + Intronic
1085501229 11:77026816-77026838 GATTTTAAAAATATAAATCAGGG - Intergenic
1085737576 11:79052596-79052618 GAGTAAAAAGAAATAAAGAAAGG + Intronic
1085922711 11:80978086-80978108 GCTTTAAAAAAAATAAAGTTTGG + Intergenic
1086275297 11:85120437-85120459 GATTCAAAACAAAGAAAGGGAGG + Intronic
1086435355 11:86774762-86774784 GATTTAAATGAGATAATGCATGG + Intergenic
1086659786 11:89401149-89401171 GATTTGAAACAACTAAAGTGAGG - Intronic
1087341240 11:96910239-96910261 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1087461084 11:98448507-98448529 GATTTTAAAAACAAAAAGCAAGG + Intergenic
1087625499 11:100591283-100591305 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1087780840 11:102300437-102300459 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1088206938 11:107403370-107403392 TATTTAGAACACATAAAACATGG + Intronic
1088547108 11:110970218-110970240 GATTGAAAACATAAAAAGAAGGG - Intergenic
1088676437 11:112198137-112198159 GATTTAAAAGAAAAACAACAAGG + Intronic
1088822066 11:113464864-113464886 GATTTAAGAACAATGAAGCAAGG - Intronic
1088838395 11:113600012-113600034 CATTGAAAACAAATGAAGTAAGG + Intergenic
1088843556 11:113646657-113646679 CATTTAAAAAAAAAAAAGAAAGG + Intergenic
1088907777 11:114167841-114167863 TATTTAAAACAACTAGAGCCAGG - Intronic
1089186258 11:116617227-116617249 GATTTTAAACAAATCTAACATGG + Intergenic
1089273788 11:117319639-117319661 GATTCAAAACAAATGAAGCTGGG + Intronic
1089414692 11:118277866-118277888 GATTTAAAAAAAAAAAACCAGGG + Intergenic
1089594710 11:119570522-119570544 AATGTTAAACAAATAAAGTAAGG - Intergenic
1089721168 11:120423838-120423860 GAATTAAACCAAACAAATCAAGG - Intronic
1089820244 11:121219349-121219371 GATATAAAAGAAACAAAGTATGG + Intergenic
1090141980 11:124275205-124275227 GATGTAAAAAAAAAAAAGGAAGG + Intergenic
1090308685 11:125715327-125715349 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1090365869 11:126205031-126205053 GCTTTAAAAGAATTAAAGGAAGG - Intronic
1090582943 11:128179831-128179853 AAGTTAAAACAAAGACAGCAAGG - Intergenic
1090785946 11:130047573-130047595 GTTTTAAAACAATTGAAGCCTGG + Intergenic
1091606416 12:1956246-1956268 GATTCATAACAAAAAGAGCATGG + Intronic
1092077838 12:5687948-5687970 GATTTAAAAGCATTAAAGAAAGG + Intronic
1092409243 12:8241491-8241513 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1092489142 12:8929408-8929430 GAATGGAAAGAAATAAAGCAAGG - Intronic
1092535677 12:9384751-9384773 GATTTAAAAAAAAAAAAGTGTGG - Intergenic
1093267402 12:17019853-17019875 AATATCAAAAAAATAAAGCAGGG - Intergenic
1093624962 12:21334666-21334688 GATTTAAAACATAAATAGCTTGG - Exonic
1093664220 12:21793308-21793330 GATTAAAAAAAGATAAAGAAGGG - Intergenic
1093832335 12:23777776-23777798 AAAATAAAACAAATTAAGCAGGG + Intronic
1094006185 12:25754400-25754422 GATTTGAATCAAATATAGCTTGG - Intergenic
1094548721 12:31429707-31429729 GTTTTAAAACAAAAAAAACCAGG - Intronic
1094626031 12:32125015-32125037 GATTTAAAATATACAAAGGAGGG - Intronic
1094662217 12:32480797-32480819 GATTTAAAAAAAAAAAAAAAAGG - Intronic
1095111952 12:38305148-38305170 GATTTACAACACAAACAGCATGG - Intergenic
1095233716 12:39772402-39772424 GATTTAAAAAAAAAATAGCACGG - Intronic
1095455216 12:42376488-42376510 GATTTAAAACAAACACAGGCTGG + Intronic
1095663071 12:44760761-44760783 AATTTAAAATAAAAAAAGAAGGG + Intronic
1095769638 12:45938621-45938643 GAATTAACATAAATAAAACAAGG - Intronic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1096703022 12:53399624-53399646 AAAATAAAACAAATAAGGCAGGG - Intronic
1097012440 12:55962824-55962846 GATTTAAAACAAAACAGGCGAGG - Intronic
1097150068 12:56970610-56970632 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1097570828 12:61328920-61328942 AATTAAGAACAAATCAAGCATGG - Intergenic
1097626050 12:62001913-62001935 GTTTTAATACAAATAAAACTTGG + Intronic
1097729202 12:63108415-63108437 GAACAAAAACCAATAAAGCATGG - Intergenic
1097762726 12:63486912-63486934 AATTTTTAAAAAATAAAGCATGG - Intergenic
1097814092 12:64052617-64052639 TATTTAAAAAAGAAAAAGCATGG + Intronic
1098022155 12:66167762-66167784 TATTCAAAAGAATTAAAGCACGG + Intronic
1098450752 12:70615799-70615821 GATAGCAGACAAATAAAGCATGG + Intronic
1098459590 12:70718239-70718261 GATTTAAAATAAATACCTCATGG + Intronic
1098616469 12:72530813-72530835 CTTTGAAAATAAATAAAGCAGGG - Intronic
1098740033 12:74161806-74161828 TATTTAAAACAAATTAATGAGGG + Intergenic
1098753217 12:74322318-74322340 TTTTTAAAACATATAAAGTATGG + Intergenic
1098795624 12:74885283-74885305 TTTTTAAAACAAATCAAGAATGG + Intergenic
1098806576 12:75027086-75027108 GATTTAAGAAAAGGAAAGCAAGG + Intergenic
1098844962 12:75523580-75523602 GATTTAAAAAAAAGAAAATAGGG - Intergenic
1099085002 12:78235115-78235137 GTTAGAAAAGAAATAAAGCAGGG + Intergenic
1099243953 12:80172420-80172442 GATTTACAAAATATAAGGCAAGG - Intergenic
1099261498 12:80388138-80388160 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1099288485 12:80745610-80745632 GAATAAAAATAAATAAAGGAAGG - Intergenic
1099299770 12:80877516-80877538 GACTATATACAAATAAAGCAAGG + Intronic
1099571626 12:84327389-84327411 CTTGTAAAACTAATAAAGCAAGG - Intergenic
1099733365 12:86534859-86534881 GTTTGCAAATAAATAAAGCAAGG + Intronic
1099737219 12:86585716-86585738 AAATTAAAAAAAATAAAACATGG - Intronic
1099907056 12:88784011-88784033 GATTAAAAAAAAATAAAAAAAGG + Intergenic
1100978818 12:100148458-100148480 TATTTACAACATAGAAAGCAGGG + Intergenic
1101401537 12:104392387-104392409 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1101495319 12:105248120-105248142 AATGGAAAACAAAAAAAGCAGGG + Intronic
1102186823 12:110955313-110955335 CATTTCAAACAAATGAAGGAAGG + Intergenic
1102374537 12:112411002-112411024 GAATTAAATGAAATAAAGCAAGG - Intronic
1102449274 12:113028737-113028759 GATTTAAAAAAAAAAAAATAGGG + Intergenic
1102593012 12:113971439-113971461 GATTTAAAACATATACAGACCGG - Intergenic
1103073939 12:117967527-117967549 GATTTAAAACAAAAAATCTAAGG + Intronic
1103236365 12:119376114-119376136 CATTAATAACAAAGAAAGCATGG + Intronic
1103868241 12:124071221-124071243 CATTTAAACCAAATAAACTATGG + Intronic
1104062467 12:125280296-125280318 GTTTTTATACAAATAATGCATGG - Intronic
1105244173 13:18633164-18633186 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1105593327 13:21813653-21813675 GATTTGTAAAAAATAGAGCATGG + Intergenic
1105627155 13:22123831-22123853 GGTTTAAAACAAACAAAGCTAGG - Intergenic
1105680459 13:22721565-22721587 TATTTAAAGAAAATACAGCATGG - Intergenic
1105914431 13:24900054-24900076 CATTAAAGAGAAATAAAGCAAGG + Intronic
1106026844 13:25963505-25963527 GATTTTGAACAAATTCAGCAAGG - Intronic
1106261579 13:28071968-28071990 GCTTTAAAGCAGATAAAGCTGGG - Intronic
1106517593 13:30468552-30468574 GATTTAAAAAAAACAAAACAAGG - Intronic
1107380487 13:39852101-39852123 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1107489571 13:40868398-40868420 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1107492005 13:40889271-40889293 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1107665298 13:42682468-42682490 AATTAAAAACAAAAAAAACAGGG + Intergenic
1107853909 13:44596093-44596115 TATTTAGAACACATAAAACAAGG - Intergenic
1108291050 13:48961481-48961503 AATTTAAAAAAAAGAAAGGAAGG + Intergenic
1108542701 13:51458683-51458705 TATTTTAAACCAATTAAGCAGGG + Intergenic
1108853872 13:54769439-54769461 TATTTAAAAGAAATAACTCATGG + Intergenic
1108943947 13:55997769-55997791 ATTTTAAAACAAATTAATCATGG - Intergenic
1109068444 13:57732316-57732338 TATTTAATATAAATGAAGCAAGG - Intergenic
1109648240 13:65289992-65290014 AAAATAAAACAGATAAAGCAAGG - Intergenic
1109659964 13:65444494-65444516 GGTCAAAAAGAAATAAAGCAAGG + Intergenic
1109662243 13:65477238-65477260 GATTTGACACATAAAAAGCAAGG + Intergenic
1109678451 13:65713063-65713085 GATTTAAATAAAGTCAAGCAGGG - Intergenic
1109813180 13:67542766-67542788 GATTTATAACACATAGATCAAGG - Intergenic
1110016891 13:70416953-70416975 AATTGAAACCAAATAAAGAAAGG + Intergenic
1110031723 13:70623831-70623853 GTTTTTAAACAAATAAAAGAGGG - Intergenic
1110397018 13:75042171-75042193 TATTTAAATAAAATAAAGCAAGG - Intergenic
1110604187 13:77412069-77412091 CATATAAAATGAATAAAGCATGG + Intergenic
1110670694 13:78173835-78173857 TATTTAAAAGAAATGAGGCAGGG + Intergenic
1111325165 13:86684409-86684431 GAATTAAACCACAAAAAGCAGGG + Intergenic
1111513245 13:89293988-89294010 AATTAAAAACAAAAAAAGAAAGG + Intergenic
1111791685 13:92864667-92864689 TATTTAAAAAAAATAAAAAAGGG + Intronic
1112028021 13:95430255-95430277 AATTTAAAACAACTCAAGAAAGG + Intergenic
1112677909 13:101725125-101725147 GAGTGAAAAGAGATAAAGCACGG + Intronic
1112692619 13:101915355-101915377 CATTTAAAACAAATACAGCTGGG + Intronic
1113635451 13:111916143-111916165 GATTTAAATGTAATAAAGCCAGG - Intergenic
1114148210 14:20003427-20003449 GAAGAAAAACAAATAAAGCAAGG - Intergenic
1114255195 14:20995866-20995888 GAAATAAAAGAAATAAAGCTGGG - Intronic
1114784310 14:25577396-25577418 AATTTAAGAGAAATTAAGCATGG + Intergenic
1114881099 14:26787337-26787359 CATTAAAAACAAATAAGTCAAGG + Intergenic
1115005524 14:28478620-28478642 TATATATAACAAATAAAGCTTGG + Intergenic
1115034561 14:28841279-28841301 GATCGAAAACCAATAGAGCAAGG - Intergenic
1115204233 14:30884854-30884876 ATTTTAAAAAATATAAAGCATGG + Intronic
1115487367 14:33924895-33924917 CCTTTAACACAAAAAAAGCAAGG - Exonic
1115843881 14:37503924-37503946 AATGGAAAACAAAAAAAGCAGGG + Intronic
1115953008 14:38742829-38742851 GATTAAAAATAAATAAAAAAGGG + Intergenic
1116770824 14:49125167-49125189 CATTTAAAAAAAAAAAAGTATGG + Intergenic
1116977696 14:51133801-51133823 GAAATAAAAAAAAAAAAGCAGGG + Intergenic
1117032421 14:51687241-51687263 TAATTAAACCAATTAAAGCAGGG - Intronic
1117317715 14:54590176-54590198 GCTATAAGAAAAATAAAGCAGGG + Intronic
1117434995 14:55707605-55707627 GATTTAAAATAAATAAGCAAAGG + Intergenic
1117532676 14:56674735-56674757 GATATAAAACAGGTAAAGCAGGG + Intronic
1117543915 14:56775295-56775317 TATTAAAAAAAAATAAAGCGAGG + Intergenic
1118069298 14:62228222-62228244 GGTTTAAATCTAATAAAACATGG - Intergenic
1118275844 14:64385697-64385719 AATGTAAAAGAAAGAAAGCAGGG - Intergenic
1118456447 14:65949165-65949187 GAAATAAAACAAATGAAGCTTGG - Intergenic
1118582267 14:67313885-67313907 GATTTAAAACAAATAAGACTTGG - Intronic
1119084470 14:71727435-71727457 GATTTAAAAAAAAAAAAAAAAGG - Intronic
1119196455 14:72720338-72720360 TAATTATAAAAAATAAAGCATGG + Intronic
1119276671 14:73362998-73363020 AATTTAAAATAAATAAAGCCGGG + Intronic
1119565280 14:75623748-75623770 GATTTAAAAAAAAATAATCAGGG + Intronic
1119600493 14:75972820-75972842 GTTTTAGACCCAATAAAGCAGGG + Intronic
1119973096 14:78994343-78994365 GTGTTAAACCAAACAAAGCAGGG - Intronic
1120053366 14:79894403-79894425 TTTTTAAAAAAAATAAAGAATGG + Intergenic
1120405507 14:84090242-84090264 GTTTTAAAACAAATAAATTTAGG + Intergenic
1120980762 14:90287130-90287152 GATTTATAATAGAGAAAGCAAGG + Intronic
1121346836 14:93142354-93142376 GATTAAAAAAAAAAAATGCATGG + Intergenic
1121838271 14:97111390-97111412 GATTTATAACATAAAAAGAAAGG - Intergenic
1121906916 14:97754383-97754405 TATTCACAACAACTAAAGCATGG - Intronic
1122175116 14:99911628-99911650 GATTTCAAACTAATAAAAAAAGG - Intronic
1123138504 14:106052759-106052781 TATTTAAAACAAATCAAGATAGG + Intergenic
1202844628 14_GL000009v2_random:156881-156903 GATGTAAAACTTACAAAGCAGGG - Intergenic
1202914022 14_GL000194v1_random:147121-147143 GATGTAAAACTTACAAAGCAGGG - Intergenic
1123465777 15:20514267-20514289 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1123652337 15:22486772-22486794 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1123664009 15:22592705-22592727 TAATTAAACCAATTAAAGCAGGG + Intergenic
1123742759 15:23295635-23295657 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1123760566 15:23428857-23428879 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1124223202 15:27867483-27867505 AATTTAAAATAAATAAATAAAGG + Intronic
1124276501 15:28330244-28330266 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1124306200 15:28581363-28581385 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1124317840 15:28687143-28687165 TAATTAAACCAATTAAAGCAGGG + Intergenic
1124565595 15:30810336-30810358 TAATTAAACCAATTAAAGCAGGG - Intergenic
1124670313 15:31633268-31633290 GGTTTAAAACAAATACAGGGGGG - Intronic
1124917950 15:33995395-33995417 GATTTAAAGTATATAAAGGAAGG + Intronic
1125334963 15:38617930-38617952 GATGGAAAGCAAATAAAGTAGGG + Intergenic
1126051120 15:44685726-44685748 AATGGAAAGCAAATAAAGCAGGG + Intronic
1126739565 15:51764081-51764103 GATTTAAAAAAAAAAAAGGAGGG + Intronic
1127138216 15:55946325-55946347 AATGGAAAACAAAAAAAGCAGGG + Intronic
1127237039 15:57065079-57065101 GATTTAAAATAAATTAAACATGG - Intronic
1127330856 15:57938738-57938760 AATGGAAAACAAAAAAAGCATGG - Intergenic
1128113731 15:65092773-65092795 AAATTAAAACAAATAAATAATGG - Exonic
1128443847 15:67739335-67739357 GATTTAAACAAAATAAGTCATGG - Intronic
1128609490 15:69062538-69062560 TATTTAAAGTAAAAAAAGCAAGG - Intronic
1128615817 15:69108619-69108641 TAATGAAAACAAATAGAGCAGGG + Intergenic
1129945729 15:79537968-79537990 GATTTAAAAAAAAAAAAGGCTGG + Intergenic
1131235179 15:90690500-90690522 GATTTAAAACATGTAAGGCCAGG - Intergenic
1131702930 15:94959431-94959453 GACTTAAAAAAAAAAAAACAAGG + Intergenic
1131814725 15:96210712-96210734 GATAATAAACAAATTAAGCAAGG + Intergenic
1132130812 15:99277018-99277040 GAACTAAAACAAATGAAGCGTGG - Intronic
1132167192 15:99605666-99605688 GATTTAAAAAAAAAAAAAAAGGG + Intronic
1132610764 16:814972-814994 GATTTAAAAGCAGCAAAGCATGG - Intergenic
1132952646 16:2572744-2572766 GAGAAAAAAAAAATAAAGCACGG + Intronic
1132961705 16:2627426-2627448 GAGAAAAAAAAAATAAAGCACGG - Intergenic
1133350214 16:5096294-5096316 GCTTTAAAGCCAATAAAACAGGG - Intronic
1133805021 16:9119679-9119701 GAATAAAAACAAAAAAACCATGG + Exonic
1134090944 16:11391490-11391512 GATCTATAACAAATAAGGCAGGG + Intronic
1134359231 16:13515664-13515686 GATTTAAAATAGATAAGACAAGG - Intergenic
1134432419 16:14223009-14223031 CATTTAAAAAAAACAAGGCAGGG + Intronic
1136675253 16:31898858-31898880 GATGGAAAGCAAAAAAAGCAGGG + Intronic
1137508586 16:49078473-49078495 GATTTAAAAAAAAAAAAGGAAGG - Intergenic
1137907277 16:52335710-52335732 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1137908040 16:52345777-52345799 GATTTTAAACAAAGATAGAAAGG + Intergenic
1137999923 16:53266798-53266820 GACTTAATACAAAGAAAGCAAGG - Intronic
1138040361 16:53657260-53657282 GTTTTAAAACAAATAATGTGGGG - Intronic
1138902565 16:61291800-61291822 AATATAAAACAGATAAAGAAAGG - Intergenic
1138960211 16:62020192-62020214 GATTTAAAAGAAAAATAGGAGGG - Intronic
1138976778 16:62217280-62217302 GATTTGAAAGAAAGAAAGGAAGG - Intergenic
1139148161 16:64347002-64347024 GATATCAAAAAAATAAAGCAAGG - Intergenic
1139556042 16:67711182-67711204 GATTTACAACCAATAATCCAGGG - Intronic
1140495784 16:75387058-75387080 AGTTAAAAACAAATGAAGCACGG + Intronic
1140498988 16:75416460-75416482 GATTTAAAAAAAAAAAAAAAAGG + Intronic
1140574450 16:76149427-76149449 GTTTTTAAACAAATGAATCAAGG - Intergenic
1140988835 16:80188366-80188388 GAATTGGAATAAATAAAGCATGG + Intergenic
1141093425 16:81146238-81146260 GATTGAAAACGAATAGAGAAAGG + Intergenic
1141215163 16:82016908-82016930 GATTTAGAGGAAATAAAGTAAGG + Intergenic
1141265437 16:82492742-82492764 CATTTAAAAAAAAAAAAACAGGG - Intergenic
1141303831 16:82842431-82842453 TATTTTAAACAAATAAAGAGTGG - Intronic
1143428448 17:6860595-6860617 AATGTAAAACAAAAAAGGCAGGG - Intergenic
1143856083 17:9850641-9850663 CACTTAGCACAAATAAAGCATGG - Intronic
1145097472 17:20042894-20042916 GATATAAAACAAATATAAGAAGG - Intronic
1146132358 17:30289614-30289636 GATTAAAAACAAAACAAGAAAGG + Intronic
1146353441 17:32114984-32115006 GATTTAAAAAATAAAAAGTAGGG + Intergenic
1146796392 17:35784378-35784400 AATTTAAAACACATACAGGAAGG + Intronic
1147497838 17:40934922-40934944 GATTTAAAAAAAAGAAAGGGAGG - Intronic
1148803579 17:50250703-50250725 TATTTAAAAAAAATAAAGAAAGG + Intergenic
1148955561 17:51350906-51350928 GAATTAACACAGATAAAGGAGGG - Intergenic
1150170605 17:62990108-62990130 GAGTAAAAACTAATAAAGGATGG + Intergenic
1150466887 17:65401190-65401212 AATTAAAAAAAAATTAAGCAAGG - Intergenic
1150756839 17:67922289-67922311 GATTTAAAAAATAAAAAGCAGGG - Intronic
1150884849 17:69072918-69072940 AATGGAAAGCAAATAAAGCAGGG + Intergenic
1151082315 17:71343080-71343102 GCTTTACAACAAATAAAACATGG + Intergenic
1151449283 17:74187879-74187901 GAGTTTAAAGAAATAAAGGAGGG + Intergenic
1151592041 17:75051578-75051600 GATTTAAAAAAAAAAAAGGTCGG - Intronic
1151607921 17:75151672-75151694 TAATTAAAAAAAATAAGGCAGGG + Intronic
1151844466 17:76642574-76642596 GAGTTAAAAAAAATACAGAAAGG - Intronic
1151931079 17:77231824-77231846 AAATTAAAATAAATAAACCAGGG - Intergenic
1152246775 17:79188690-79188712 CATTTAAAATAAATAAAGCTTGG - Intronic
1152440265 17:80304220-80304242 AATGGAAAAGAAATAAAGCAAGG - Intronic
1153461498 18:5338790-5338812 TATTTGAAACAAATAAACAAGGG - Intergenic
1154390220 18:13930435-13930457 GATTAAAAACAACTAGAGAATGG + Intergenic
1155502434 18:26500257-26500279 AATTTAAAAAAAAAAAAGCTGGG + Intronic
1155593015 18:27449685-27449707 ATTTTAAAACAAATAGAGGAAGG + Intergenic
1155736730 18:29233450-29233472 GAAACAAAACAATTAAAGCATGG + Intergenic
1155739494 18:29270150-29270172 AATTTAATACCAATAAAGCAGGG - Intergenic
1155815781 18:30307725-30307747 TATTTAAAAAAAAAATAGCAGGG - Intergenic
1155850183 18:30764633-30764655 TATTTAAAAACAATAAAGCTTGG - Intergenic
1156617898 18:38809740-38809762 GTTTTAAACCACATAAATCAAGG - Intergenic
1156722702 18:40089774-40089796 GATTAAAAAGAAAGCAAGCATGG - Intergenic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1156785348 18:40906066-40906088 GATGTAAAACAAGTATTGCATGG - Intergenic
1156821831 18:41382423-41382445 GATTTATAACAAAAAAAGTGAGG - Intergenic
1157344088 18:46807708-46807730 TATTTAAAACTAAGAAAGCTTGG + Intergenic
1157648346 18:49301112-49301134 GATTTCAAATTAATAAATCAAGG + Intronic
1157773187 18:50368779-50368801 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1158293596 18:55969488-55969510 GAGTGAAAACCACTAAAGCATGG + Intergenic
1158992598 18:62885347-62885369 TTTTTAAAACAAGTAAACCACGG - Intronic
1158996660 18:62927473-62927495 GATATAAAACAAAGAAATTAAGG + Intronic
1159048588 18:63395044-63395066 GCTTTAAAAGAAGTAAAGGATGG + Intronic
1159302985 18:66600288-66600310 GATTTTTAAAAAATAAAGTAAGG - Intronic
1159785822 18:72713078-72713100 AATTTAAAAAAAATATAGCCAGG - Intergenic
1160304751 18:77721982-77722004 TATATAAAACAACTAAATCACGG + Intergenic
1160312269 18:77806761-77806783 GATTGAAAACAAACAAAAAAAGG - Intergenic
1160597899 18:79989696-79989718 AATTTAAAACAAATCACGCCCGG + Intronic
1162648921 19:12070269-12070291 GCTTAAAAACAAAAAAAGAAAGG + Intronic
1163029228 19:14533107-14533129 GTTTTAAAAAAAATAAATAAAGG + Intronic
1163178098 19:15579137-15579159 GATTTAAAAAAACAAAAACATGG - Intergenic
1163258777 19:16173948-16173970 GATTTAAAAAAAAAAAAAAAAGG + Intergenic
1163526755 19:17826085-17826107 AATTTAAAAAAAAAAAAGCCTGG + Exonic
1164000464 19:21093597-21093619 GATTTAATAAAAACAAAGTATGG - Intronic
1164135899 19:22416167-22416189 AATTTAAGAAAAATAAAGTATGG + Intronic
1164163630 19:22648701-22648723 GATTTAAAAAAGACAAAGAAGGG - Intronic
1164487833 19:28676297-28676319 GATTTAAAACAAAAATAGCCAGG + Intergenic
1165043805 19:33088337-33088359 AATTAAAAAAAAAAAAAGCAAGG - Intronic
1166132372 19:40753767-40753789 GATTTAAAAACAAAAAACCAGGG - Intronic
1167557408 19:50204896-50204918 GATTTAAAAAAAAAAAAAGAGGG - Intronic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
1168333474 19:55583311-55583333 GATTTAAAAGAAATAATAAAAGG + Intergenic
1168548476 19:57273524-57273546 AGTTTAAAACAAAAAAAGCAAGG - Intergenic
925557598 2:5148461-5148483 GACTGAAAACAAATAAATCGAGG - Intergenic
925642608 2:6000624-6000646 GCTTTAAAGTAAATAAAACAAGG - Intergenic
925670218 2:6302996-6303018 GATATAAAGGAAATATAGCAAGG + Intergenic
925681228 2:6423611-6423633 GCTTTGAAACAAAGAAGGCATGG + Intergenic
925753719 2:7112668-7112690 GATTTTAAAGAAAGAAATCATGG - Intergenic
926088448 2:10034715-10034737 CATTTCTAACAAATAAAGTATGG - Intergenic
926266415 2:11326225-11326247 CATTTAAAAAAAAAAAAGTAAGG + Intronic
926489325 2:13504343-13504365 GTTTAAAAAAAAATAAAGCCTGG - Intergenic
926923189 2:17959858-17959880 GATCTAAAACAATTAATGAAAGG + Intronic
926930419 2:18032795-18032817 CATTCAAAACAAAAAAAGAACGG - Intronic
926938352 2:18109660-18109682 AATTTAACAAAAATAAATCAGGG - Intronic
927109514 2:19854359-19854381 GTTTAAATATAAATAAAGCAGGG + Intergenic
927750544 2:25665772-25665794 GATTTAAAAAAAAAAAAAAAAGG + Intronic
927806422 2:26150738-26150760 TATTTAGAACACATAAAACAAGG - Intergenic
927994680 2:27475772-27475794 AATTTAAAAAAAAAAAAGAATGG - Intronic
928406326 2:31017798-31017820 AATTTAAAAGAGATTAAGCAGGG + Intronic
928522500 2:32104275-32104297 AATGGAAAACAAAAAAAGCAGGG - Intronic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
929205262 2:39284548-39284570 TATTTAAAATAAATAAGGCTGGG + Intronic
929268475 2:39945432-39945454 GATATAAAAAAGAAAAAGCATGG - Intergenic
929842447 2:45483096-45483118 AATTTTAAAAAATTAAAGCAAGG + Intronic
931058351 2:58498585-58498607 CATTTAAAAACAAAAAAGCAAGG - Intergenic
931191327 2:60003118-60003140 GAATTAAAAGTAATAAAGAAAGG + Intergenic
931331042 2:61283816-61283838 AATATAAAACAAATAAATAATGG - Intronic
931555794 2:63502775-63502797 GATTTAAAAAAAAAAAAACTGGG + Intronic
931769278 2:65483828-65483850 GATTTTAACCAAATATAGCAAGG - Intergenic
932268721 2:70390395-70390417 TATTTAAAACAAATAAACAAAGG + Intergenic
932402532 2:71491406-71491428 AATTTAAAACAAACAAATAAAGG - Intronic
932924824 2:75960738-75960760 GATTACAAATTAATAAAGCATGG - Intergenic
933016774 2:77137792-77137814 AATTTAAAACAAAAAAAGGCAGG + Intronic
933106339 2:78330846-78330868 GATTTAAAAAAAATAAAGGTGGG - Intergenic
933392841 2:81693970-81693992 GATTTAAAAAAAAAAATGAAAGG - Intergenic
933472986 2:82750747-82750769 AATGGAAAACAAAAAAAGCAGGG + Intergenic
933482383 2:82874178-82874200 GATTTAAATAAAATCAAGGAAGG - Intergenic
933507272 2:83193501-83193523 GATTTAAAACAAAACAAGAAAGG - Intergenic
933667869 2:84979144-84979166 GTTTAAAAACAAAAAAAACATGG - Intronic
934959438 2:98656769-98656791 GAATTAAAAAAAAAAAATCAAGG + Intronic
935711222 2:105900896-105900918 AATGGAAAACAAAAAAAGCAGGG - Intergenic
936413540 2:112282322-112282344 AATCTAAAAAAACTAAAGCAGGG - Intronic
936438270 2:112527635-112527657 AATGGAAAACAAAAAAAGCAGGG - Intronic
936604112 2:113931017-113931039 CATTAAAAAGAAATGAAGCAGGG - Intronic
936620021 2:114086060-114086082 ATTTTTAAAGAAATAAAGCATGG - Intergenic
936688620 2:114858948-114858970 GATTTGTAACAAACAAAGGATGG - Intronic
936782647 2:116052765-116052787 AATGGAAAACAAAAAAAGCAGGG - Intergenic
936788485 2:116123529-116123551 AATGGAAAACAAAAAAAGCAGGG - Intergenic
936965601 2:118124796-118124818 AATTAAAAAAAAAAAAAGCAAGG - Intergenic
936992457 2:118380689-118380711 CCTTTACAACAAATAAACCAAGG + Intergenic
937192096 2:120112113-120112135 GAGTGAGAAAAAATAAAGCAGGG - Intronic
937502841 2:122500665-122500687 TATTTAAAAAAAATAAATCCTGG - Intergenic
937534615 2:122870686-122870708 TATTTAAAACAAATAAAAGATGG - Intergenic
937600885 2:123730450-123730472 ACTTTAACCCAAATAAAGCATGG + Intergenic
937797152 2:126037207-126037229 CATGTAAAACAAGGAAAGCAGGG + Intergenic
938126330 2:128675168-128675190 AATTGAAAACAAAAAAAGTAGGG + Intergenic
938403540 2:131013894-131013916 TATTTAAAACAAATTAGGCCGGG - Intronic
939039559 2:137171839-137171861 GATTGAAAAGAAATGAAGAAAGG - Intronic
939099850 2:137883340-137883362 GCTTTAAAAAAAAGAAAGTAGGG + Intergenic
939992951 2:148893126-148893148 GATTAAAAACAAAACAAGCCAGG - Intronic
940045594 2:149406556-149406578 AATGGAAAACAAATAAGGCAGGG - Intronic
940196258 2:151097556-151097578 GACTTAATAAAAATAAATCAGGG + Intergenic
940255055 2:151719575-151719597 TATTTAAAAGAAATTAAGCCAGG - Intronic
940526935 2:154828177-154828199 CATTTAAAAATTATAAAGCATGG + Intronic
941011622 2:160306615-160306637 AATTTAAAAAAAAAAAAGAATGG + Intronic
941213113 2:162667744-162667766 GCCATAAAGCAAATAAAGCAAGG - Intronic
941438089 2:165496776-165496798 GATTTAAAAAAACAAAATCACGG - Intronic
941836628 2:170028637-170028659 CATTTATAACAAAAAAAGAAGGG + Intronic
941872007 2:170395749-170395771 GATTTACAAAAAAGAAAGAAAGG + Intronic
941886977 2:170538205-170538227 GAATTAAAGCAAAAGAAGCAGGG - Intronic
941913646 2:170792167-170792189 AACTTAAAAAAAATAAACCATGG - Intronic
942195051 2:173508808-173508830 GATTTAAAACAGATATTGTATGG - Intergenic
942360433 2:175167317-175167339 GATTTAAAAAAAAAAAAATAAGG + Intronic
942363874 2:175201265-175201287 AATTTAAAACATATTAAGAAAGG + Intergenic
942523938 2:176832978-176833000 AATTTAAAACATACAAATCATGG + Intergenic
942661948 2:178274892-178274914 CATTTAAAAAAAAAAAATCATGG - Intronic
942789557 2:179744310-179744332 GATTTAAAAAAAAAAAAAAATGG - Intronic
943457504 2:188125688-188125710 AATGGAAAACAAAAAAAGCAGGG + Intergenic
943493816 2:188592659-188592681 CATTAATAACAAATAAAGTATGG + Intronic
943497940 2:188648377-188648399 GTTTGAAAACAAGTAAAGCAGGG + Intergenic
943945869 2:194063416-194063438 GCTTTGAAACAAGTAAAGAATGG + Intergenic
944085305 2:195839532-195839554 TATTGAAAACAAAAAAAGAATGG + Intronic
944396314 2:199271556-199271578 GAATTAAAAAAAAAAAATCAGGG + Exonic
944569220 2:201026132-201026154 AATGGAAAACAAAAAAAGCAGGG + Intronic
944785907 2:203069953-203069975 AATTTAAAACAAATCAGGCTGGG - Intronic
945390886 2:209263688-209263710 AATGGAAAACAAAAAAAGCAGGG + Intergenic
945422009 2:209649646-209649668 GATTTCAAACTAAAATAGCATGG - Intronic
946062949 2:216960597-216960619 GATAAATAACAAATAATGCATGG - Intergenic
946113126 2:217437578-217437600 AATTTAAACCAAATAAGGCAGGG - Intronic
946118920 2:217491758-217491780 GATTAAAAAAAAATAAGGCAAGG - Intronic
946351231 2:219155263-219155285 GTTTTAAACGAAATAAAGTATGG + Intronic
946383386 2:219364995-219365017 GATTAAAAAAAAAAAAAGCCAGG + Intergenic
946634761 2:221712424-221712446 GATTTTAAAGAAGTAAATCAAGG + Intergenic
947079025 2:226375197-226375219 GAAAAAAAACAAATAAGGCAAGG - Intergenic
947143671 2:227043275-227043297 TATTTAAAACTAAAAAAGTAAGG - Intronic
947250967 2:228103366-228103388 TAGAGAAAACAAATAAAGCAAGG - Intronic
947287132 2:228529377-228529399 GAGTTAAAAAAATTAAATCATGG + Intergenic
947779257 2:232742703-232742725 GATTTAAAACTAATAGGACATGG + Intronic
1168780016 20:481205-481227 CAATTACAACCAATAAAGCAAGG + Exonic
1168873009 20:1146991-1147013 TATTTAAAAAAAATAAAACAAGG - Intronic
1169153846 20:3312420-3312442 GCTTTAAAAAAAAAAAAGTATGG + Intronic
1169244290 20:4013928-4013950 GTTTTAAAACCAAAATAGCAAGG + Intronic
1170250222 20:14272812-14272834 AATGTAAAACAAAAAAGGCAGGG + Intronic
1170253680 20:14315778-14315800 GATTTAAAACAATTAAATGTTGG + Intronic
1170774999 20:19367484-19367506 GGTTTAAAAAAAAAAAGGCAGGG - Intronic
1170785115 20:19460972-19460994 GCTTTAAAACAACCAAAGCCTGG - Intronic
1171943296 20:31351797-31351819 GTATTAAAAGAAATAAAGGATGG + Intergenic
1172578795 20:36030669-36030691 TATTTAGGACAAATAAAGGATGG + Exonic
1172709641 20:36911080-36911102 AATTTTAAAAAAATAAAGAAAGG - Intronic
1173208679 20:41014963-41014985 CATTGGAGACAAATAAAGCAGGG + Intergenic
1173290381 20:41709870-41709892 TCTCAAAAACAAATAAAGCAAGG - Intergenic
1174444960 20:50584550-50584572 AAATAAAAACAAAAAAAGCAAGG + Exonic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1174972521 20:55292367-55292389 GTATTAAGACAAATAAAGCGAGG - Intergenic
1175015551 20:55786268-55786290 GATTTAAAAAAAAAAAAAAAAGG + Intergenic
1175480905 20:59310102-59310124 AATTTAAAACAAAGGAAGCTGGG + Intronic
1175628229 20:60507774-60507796 GATTTGAAAAAAAGAAATCATGG - Intergenic
1175880897 20:62258231-62258253 GCTTCAAAACAAATAATGGAAGG + Intronic
1176633377 21:9161795-9161817 GATGTAAAACTTACAAAGCAGGG - Intergenic
1177056544 21:16311341-16311363 TATTTAAAGCAAATAGAACATGG - Intergenic
1177076108 21:16575581-16575603 GATTTAAAAAAAAAAAAAAAAGG + Intergenic
1177098922 21:16875138-16875160 GCTTCAAACCAAAGAAAGCATGG + Intergenic
1177268415 21:18813068-18813090 GTTTTACTACAAAGAAAGCAAGG + Intergenic
1177475016 21:21608836-21608858 GATTAAAAACAAACAAAAAAAGG + Intergenic
1177716622 21:24847010-24847032 GATTAAAAAAAAAAAAAACAAGG - Intergenic
1177870443 21:26566461-26566483 GATTTAAAACCACTAAAGGGTGG - Intronic
1177993716 21:28070254-28070276 CTTTTAAAAGAAATAAATCAAGG + Intergenic
1178547532 21:33505210-33505232 GCTTCCAAACAAATAAAGGAAGG + Intronic
1178929088 21:36801777-36801799 AATTTAAAAAAAAAAAAGAAAGG - Intronic
1179156290 21:38853851-38853873 GAGTTAAATCAAATGATGCAAGG - Intergenic
1179321144 21:40292055-40292077 GATTTAAAAAAAAAAAATCAGGG - Intronic
1180072225 21:45442259-45442281 GATTTAAAGGAGAAAAAGCAAGG - Intronic
1180504719 22:15983916-15983938 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1180616049 22:17128243-17128265 AATTAAAAAAAAATAAAGAATGG - Intronic
1181883559 22:26000580-26000602 GATTTAAAAAAAAAAAAAAAAGG - Intronic
1182650314 22:31846346-31846368 GGTTAAAAACAAAAAAAACATGG - Intronic
1182918258 22:34055395-34055417 GATTTTTAACAAATAAAGTGTGG + Intergenic
1182939327 22:34259774-34259796 GTTTTTAAAGAAATAAAGAATGG + Intergenic
1183119637 22:35720372-35720394 GATTTTAAACAAACAAACCATGG - Intronic
1184522892 22:45006350-45006372 GTTTAAAAAGAAAGAAAGCAAGG - Intronic
949687176 3:6589081-6589103 AATGGAAAACAAAAAAAGCAGGG + Intergenic
950823831 3:15793763-15793785 CATTTAAAACAAATAAATCATGG + Intronic
951201476 3:19879829-19879851 GTTTTAAAACATATAAATCATGG - Intronic
951277763 3:20710650-20710672 GAATGAAAATAAATAAAACAAGG + Intergenic
951368513 3:21814501-21814523 AATGGAAAACAAAAAAAGCAGGG + Intronic
951389434 3:22084396-22084418 AATGGAAAACAAAAAAAGCAGGG + Intronic
951514858 3:23547595-23547617 GATTTATAACTAATGCAGCATGG + Intronic
951829972 3:26915614-26915636 GATTAAAAAAAAAAAAAGAAAGG + Intergenic
951949578 3:28184809-28184831 GACTTAAAATAAAAAGAGCACGG + Intergenic
952437285 3:33284868-33284890 AATGGAAAACAAAAAAAGCAGGG - Intronic
952651176 3:35728521-35728543 GATTTAAAAAAAAAAAAAAAAGG - Intronic
953161224 3:40421795-40421817 GCTTTAAAAAAAGAAAAGCATGG + Intronic
953196720 3:40741146-40741168 CATGTAAAACACATAAAGCCTGG + Intergenic
953351214 3:42217646-42217668 CATTTAAAAGAAATCAAACAAGG - Intronic
954143823 3:48624166-48624188 GCTTTGAAGAAAATAAAGCAGGG - Intergenic
954992450 3:54853206-54853228 GATTCAAGAAAACTAAAGCAGGG - Intronic
955401706 3:58596354-58596376 GTTTAAAAACAAATAAAGCAAGG - Intronic
955477927 3:59358616-59358638 AATGGAAAACAAAAAAAGCAGGG - Intergenic
955626599 3:60925875-60925897 AATGGAAAACAAAAAAAGCAGGG + Intronic
955654770 3:61232872-61232894 CAGTCAAACCAAATAAAGCAAGG + Intronic
955804988 3:62724412-62724434 GTTTAAAAACAAATGAATCAAGG + Intronic
956032103 3:65049560-65049582 GCTATTAAAGAAATAAAGCAGGG - Intergenic
956128259 3:66031569-66031591 GTTTTACAAAAAATGAAGCAAGG - Intronic
956225235 3:66950204-66950226 GATTTAAAACATTTAAAGGAAGG + Intergenic
956497105 3:69839747-69839769 TATTTAAAAAAAAAAAAGTAAGG + Intronic
956757429 3:72402748-72402770 GTTTTAAGACAAATTAAACAGGG - Intronic
957054509 3:75433657-75433679 GCTTTAAAGCCAATAAAACAGGG - Intergenic
957241162 3:77663007-77663029 GATGTAAAACAAATACATCAGGG + Intergenic
957354902 3:79069374-79069396 GAATAAATACAAATAAAGAATGG - Intronic
957382056 3:79444677-79444699 TATTTAAAAAAAATAAAGTTTGG - Intronic
957511431 3:81193343-81193365 CATTTAAAACTACTATAGCACGG + Intergenic
957955840 3:87185767-87185789 AATTTAAAAAAAACAAAGAATGG + Intergenic
958523683 3:95224934-95224956 GATTAAAAAAAAAAAAAGAAGGG - Intergenic
958549236 3:95593239-95593261 GATTTAAAGCAGATCAAGGAAGG - Intergenic
958704353 3:97634934-97634956 GATTAAAAAAAAAAAAAGCTAGG - Intronic
959294602 3:104519978-104520000 GATCCAAAACAGAAAAAGCAGGG + Intergenic
959307399 3:104687006-104687028 TATTTATAACAAATATATCAGGG - Intergenic
959523664 3:107350080-107350102 TTTTTAGAACTAATAAAGCATGG - Intergenic
959625931 3:108451082-108451104 GATTTAAAAATAATAAGGCCAGG + Intronic
959656506 3:108811591-108811613 GATTTTAAAGAAATTAAGAAAGG + Intergenic
960333006 3:116385877-116385899 TGTATAAAAGAAATAAAGCAAGG + Intronic
960871211 3:122251788-122251810 GATCTAAACAAAATAATGCATGG - Intronic
961300339 3:125918048-125918070 GCTTTAAAGCCAATAAAACAGGG + Intergenic
962461415 3:135617534-135617556 ACTGTAAAGCAAATAAAGCAAGG + Intergenic
962565210 3:136650917-136650939 GAATTAAAAAAAAAAAAACAAGG + Intronic
962679278 3:137781874-137781896 GATTAAAAAAAAAAAAATCAAGG + Intergenic
962953081 3:140238450-140238472 GAATTAAAATAAATCAAGAATGG - Intronic
963476939 3:145818668-145818690 TATTAAAAACAAAAAAAGCAAGG - Intergenic
963692424 3:148520733-148520755 AATTTAAAAACAATATAGCATGG + Intergenic
963807475 3:149739267-149739289 TATATAAAACAAACAATGCAGGG + Exonic
963854807 3:150242536-150242558 TAATTCAAACAAATAAAACAGGG - Intergenic
963888304 3:150604739-150604761 GATTAAAAACAAACAAGGCCGGG + Intronic
964036280 3:152201812-152201834 GATTATAAACAAATAAAGCAGGG - Intergenic
964143131 3:153426329-153426351 AAATTAAAACAAATAACTCATGG + Intergenic
964197120 3:154077807-154077829 GATTCATAACAAATAGAACAGGG + Intergenic
964715467 3:159716568-159716590 AATGTAAAACAAAGAAAGCAAGG + Intronic
965357552 3:167694921-167694943 GATAAAAAACAAAGAAAGCTGGG - Intronic
965449607 3:168821134-168821156 AATTTAAAATAAACAAAGCGTGG + Intergenic
965475683 3:169152226-169152248 AATTTAAAAAAAATAAAAAAAGG - Intronic
965552452 3:169981731-169981753 GATAAAAAATGAATAAAGCAAGG + Intronic
965779048 3:172264295-172264317 TATTTAAAAGAAATGATGCAGGG - Intronic
965878162 3:173353701-173353723 GATTCAAAAAAAAAAAAGAATGG - Intergenic
966024844 3:175265179-175265201 AACTTAAAACAAACAGAGCAGGG - Intronic
966367711 3:179207813-179207835 GATTTAAAAAAAATTAGGCTGGG - Intronic
966442601 3:179962913-179962935 GATTAAAAAGAAAGAAAACATGG + Intronic
966562270 3:181336120-181336142 GGATTAAATGAAATAAAGCATGG + Intergenic
967138913 3:186536696-186536718 GATCTCAATAAAATAAAGCAAGG - Intergenic
967443426 3:189536319-189536341 GATTTAAAACAACACAAACATGG - Intergenic
967475466 3:189911661-189911683 TATTTAATAAAAATAAAGAAAGG - Intergenic
967715848 3:192760388-192760410 AATGGAAAACAAAAAAAGCAGGG + Intronic
967861100 3:194152498-194152520 GATTTGAAAAAAAGAAAGAAAGG - Intergenic
968354801 3:198097712-198097734 TATGTAAAACAAATAAAAAATGG - Intergenic
968768119 4:2485338-2485360 AATTTAAAAGAAACAAAGCTAGG - Intronic
969756698 4:9154715-9154737 GCTTTAAAACCAATAAAACAGGG + Intergenic
969816666 4:9692284-9692306 GCTTTAAAGCCAATAAAACAGGG + Intergenic
970278118 4:14424363-14424385 AATGGAAAACAAAAAAAGCAGGG - Intergenic
970374577 4:15443868-15443890 TATTTATTTCAAATAAAGCAAGG + Exonic
970400167 4:15709562-15709584 GATGAAAAACACATAAAGAAAGG + Intronic
970455986 4:16225092-16225114 GAACTAAACCAAATAAAGTATGG + Intronic
970715710 4:18920097-18920119 CATTGAAAAAAAATAAAGTAAGG + Intergenic
971079221 4:23190145-23190167 GAATTAAAAAAAAGAAAACAAGG - Intergenic
971186360 4:24380976-24380998 GATTTAAAAAAAAAAAAAAAAGG + Intergenic
971339777 4:25757482-25757504 TATTAAAAAAAAAAAAAGCAGGG - Intronic
971389624 4:26173813-26173835 ATATTAAAATAAATAAAGCAAGG + Intronic
971841949 4:31864125-31864147 GATTAAAAAAAAATAACACAGGG + Intergenic
971940126 4:33203174-33203196 GATTTAATACAAATGGAGGAAGG - Intergenic
972127354 4:35785321-35785343 GATTTAAAAAAAAAAGAACAAGG - Intergenic
972144824 4:36010310-36010332 CATTGAAAAGAAATAAAGAAAGG + Intronic
972769019 4:42178926-42178948 GATATAAAAGAAATAAGGGAAGG + Intergenic
973218816 4:47702261-47702283 AATTTTAAACAAATACAGGATGG + Intronic
974299898 4:60049874-60049896 AATGGAAAACAAAAAAAGCAGGG - Intergenic
974459885 4:62173635-62173657 AACTTAATACAAATCAAGCAAGG - Intergenic
974680933 4:65160923-65160945 AATGTAAAACAAAAAAGGCAGGG + Intergenic
974741997 4:66019398-66019420 AATATAAAACAGAAAAAGCAGGG - Intergenic
974917517 4:68196365-68196387 AATGCAAAACAAAAAAAGCAGGG + Intergenic
975324086 4:73040598-73040620 GATGGAAAACACCTAAAGCAAGG - Intergenic
975341182 4:73242860-73242882 TATTTAATACTAATAAAGCTTGG + Intronic
975476632 4:74831033-74831055 GTTTTAAAAAAAAAAAAGTATGG + Intergenic
975616677 4:76253804-76253826 GAATTAAAAAAAAAAAAGAAAGG + Intronic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
975943487 4:79676387-79676409 AATTTAAAAAAAAAAGAGCAGGG - Intergenic
976424772 4:84890007-84890029 GCTATAAAACAAAATAAGCAAGG + Intronic
976442668 4:85093544-85093566 CATATAAAAGAAAGAAAGCAGGG + Intergenic
976504008 4:85825251-85825273 GATTTAAAACATTTACAGCTGGG + Intronic
976574423 4:86652916-86652938 GAATAAAAAAGAATAAAGCATGG - Intronic
976819115 4:89184986-89185008 CATTTAAAACAGAAAAAGTAAGG + Intergenic
977424044 4:96843046-96843068 GAATTAAATAAAATAATGCATGG - Intergenic
977548192 4:98410877-98410899 GATTTGAGACAAATGAAGGAAGG + Intronic
977828043 4:101556495-101556517 GATTTATATAAAATAAAGAATGG - Intronic
977911598 4:102543600-102543622 GATTTAAAAAAAAAAAAAAAAGG + Intronic
978052007 4:104212653-104212675 GCTTTAAAAGAAATAAAGACAGG - Intergenic
978383052 4:108150991-108151013 GACTTACATCAAATAAAGTATGG + Intronic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
978756905 4:112312588-112312610 TATTAAAGACAAATACAGCATGG + Intronic
978802674 4:112770349-112770371 GATTTAAAACAAAACAATGAAGG - Intergenic
978876972 4:113652274-113652296 GAATTAAAATAACTAATGCATGG + Intronic
979201387 4:117983615-117983637 CATTTAAAATAACTAAAGAAAGG + Intergenic
979298976 4:119065729-119065751 AATGGAAAACAAAAAAAGCAGGG - Intergenic
979367748 4:119845977-119845999 GATTTAAATAACATAAAGAATGG + Intergenic
979870284 4:125810616-125810638 TATTTAAAACAAACAAAAAAAGG + Intergenic
979872999 4:125850155-125850177 GATTTAAAGAAAATGAAGAAGGG - Intergenic
980077002 4:128304238-128304260 GAATTAAGTCAAATAAAGTAAGG - Intergenic
980485783 4:133456268-133456290 AATTCAAAATAAATAAAGGATGG + Intergenic
980813728 4:137916428-137916450 AATGGAAAACAAAAAAAGCAGGG + Intergenic
981337620 4:143584449-143584471 AATGGAAAACAAAAAAAGCAGGG + Intronic
981674939 4:147332001-147332023 GCTATAAAACAAATAAAAAATGG + Intergenic
981988135 4:150882773-150882795 AATTTATAACAATTTAAGCAGGG + Intronic
982023720 4:151231235-151231257 GATTCCAAACAAATAGACCATGG + Intronic
982502141 4:156170693-156170715 GATGAAAAACAAATATGGCAGGG + Intergenic
982674012 4:158354926-158354948 GACTTAAAAGAAATTAAGCCAGG - Intronic
983362622 4:166745806-166745828 AATGTAAAACAAAAAAAGCAGGG + Intronic
983364432 4:166768012-166768034 AATGTAAAACAAAAAAAGCAGGG - Intronic
983364767 4:166771450-166771472 TATTAAAAACAAACAAAGCAAGG + Intronic
983463130 4:168051165-168051187 GATTTCCAACAAAGAAACCAAGG - Intergenic
983507359 4:168568983-168569005 AATTTAAAAAAAAGAAAGAAAGG + Intronic
983602491 4:169546798-169546820 AATGGAAAACAAAAAAAGCAGGG - Intronic
983797244 4:171880121-171880143 GATCTAAAATAAATGAAACATGG - Intronic
983867433 4:172785636-172785658 GAGTTAAGAAAAATAAAGTAGGG + Intronic
984003355 4:174278780-174278802 GCTTTTATACAAATAAAACAAGG + Intronic
984331008 4:178318404-178318426 AATATTAAACAAAAAAAGCAAGG - Intergenic
984546248 4:181107628-181107650 CATTAAAAATAAATAAACCAAGG - Intergenic
984594274 4:181649665-181649687 AGTTTAAAACAAACAAATCACGG - Intergenic
986656152 5:10014838-10014860 AATGGAAAGCAAATAAAGCAGGG - Intergenic
986801954 5:11269893-11269915 GATTGAAAACGAAAAAAACACGG + Intronic
987125982 5:14813236-14813258 TATTTAAAAAAAAAAAAGCATGG + Intronic
987435566 5:17889065-17889087 GACATAAAATTAATAAAGCAAGG - Intergenic
987626596 5:20408892-20408914 TAATTAAAACAAAGAAAGCTAGG + Intronic
987934778 5:24450108-24450130 GATTTAAAAAAAAAAAACTATGG - Intergenic
988182142 5:27810067-27810089 GTTTTAAAATAAGTAGAGCATGG + Intergenic
988218168 5:28304163-28304185 GATTAAAATCTAAGAAAGCATGG + Intergenic
988417314 5:30961495-30961517 GATGTATAAACAATAAAGCAAGG + Intergenic
989065265 5:37453932-37453954 GCTATAAAAGAAATAAATCAGGG - Intronic
989284328 5:39681993-39682015 TATTAATAATAAATAAAGCATGG + Intergenic
989517027 5:42355488-42355510 AATGGAAAACAAAAAAAGCAGGG + Intergenic
989583496 5:43055432-43055454 AATGGAAAACAAAAAAAGCAGGG + Intergenic
990064143 5:51691436-51691458 GATTTAAAACATTTTAAGCTTGG + Intergenic
990238698 5:53795346-53795368 GATAAAAAAAAAATAAAGTAAGG - Intergenic
990282398 5:54265119-54265141 TATTTAAAAAAATTACAGCAGGG - Intronic
990288221 5:54322168-54322190 GATTAAAAACAAATATGGCCTGG + Intergenic
990433079 5:55756989-55757011 GATTTAAAACTACTAAAAAATGG + Intronic
990479678 5:56198042-56198064 GTAATAAAACAAATAAAGAAGGG - Intronic
990857311 5:60283524-60283546 GTTTTAAAAGAAATAAAAAATGG + Intronic
991080223 5:62590269-62590291 GGATTAAAACTAATAAATCAGGG + Intronic
991106398 5:62847993-62848015 GATTTATACCAAAGAATGCAAGG - Intergenic
991803123 5:70396264-70396286 CATTTAAAACAAATAATTGAGGG - Intergenic
991823574 5:70590967-70590989 CATTTAAAACAAATAATTGAGGG + Intergenic
991888142 5:71294942-71294964 CATTTAAAACAAATAATTGAGGG + Intergenic
992031928 5:72729915-72729937 AATGGAAAACAAAAAAAGCAGGG + Intergenic
992209662 5:74465715-74465737 GGTTAAAAACAAAAAAAGCCAGG + Intergenic
992244619 5:74807705-74807727 TATTTAAAACAAATGAATTATGG + Intronic
992327155 5:75671695-75671717 GATTTAAAAAAAAAAAAAAATGG - Exonic
992893523 5:81226665-81226687 GAAAGAAAACAAACAAAGCAAGG - Exonic
992968419 5:82028387-82028409 ACTTTGAAACAAATAAAGTATGG + Intronic
992985119 5:82220555-82220577 GATTTAAAAAAAATCCAGCCAGG - Intronic
993118640 5:83747305-83747327 GTGTTAAAAAAAATAAATCATGG - Intergenic
993710648 5:91221471-91221493 GTTTTAAAAGTAATACAGCAAGG + Intergenic
993757399 5:91749026-91749048 AATGAAAAGCAAATAAAGCAGGG - Intergenic
993767059 5:91873357-91873379 TATATAAAACAAATAAACAAAGG + Intergenic
993814577 5:92526376-92526398 CATATAGATCAAATAAAGCATGG + Intergenic
993888500 5:93444368-93444390 AATGGAAAACAAAAAAAGCAGGG + Intergenic
993935357 5:93993937-93993959 GAATTATAACAAAATAAGCATGG + Intronic
994384643 5:99116024-99116046 AATTTAAAACAAATATAGAGTGG - Intergenic
994424430 5:99566132-99566154 CATTTTTAACAAATAAAGTAAGG + Intergenic
994512368 5:100720788-100720810 GCTTAAGAAAAAATAAAGCATGG - Intergenic
994564168 5:101419141-101419163 AATAAAAAATAAATAAAGCAAGG - Intergenic
994760839 5:103851431-103851453 GATTTAAAAAAAAAAAAGATAGG + Intergenic
995397918 5:111707974-111707996 CCTTTAACACAAATACAGCAGGG - Intronic
996639791 5:125738682-125738704 AATGGAAAACAAAAAAAGCAAGG - Intergenic
996723450 5:126652194-126652216 GACTTAAAAAAAAAAAATCATGG - Intergenic
996896832 5:128494280-128494302 TATTTAAAATAGATAAAGTAGGG + Intronic
997349717 5:133221810-133221832 GATTTAAAAGAAATGAAGAAAGG - Intronic
997569804 5:134917631-134917653 GATACAAAACCAATAAAGCTTGG - Intronic
998084478 5:139306853-139306875 GACTAAAAACAAAAAAATCAAGG - Intronic
998119416 5:139563321-139563343 GATTTCTAACAAATGAAGAAGGG + Intronic
998599580 5:143571420-143571442 GATGGCAAACAAATAAATCAGGG - Intergenic
999166025 5:149550509-149550531 GAATTAAAAAAAAAAAAACATGG + Intronic
999329110 5:150660757-150660779 GACTGAAAATAAATAAGGCAGGG - Intergenic
999855443 5:155588335-155588357 GATTTAACACAAATCAGGCCAGG + Intergenic
999860493 5:155640472-155640494 CATCTAAAACACAAAAAGCAAGG - Intergenic
1000114403 5:158139674-158139696 AATCTAAAACAAATAAACTATGG - Intergenic
1000794094 5:165643389-165643411 GATTTAAAATAAGTAAAGTTAGG - Intergenic
1001348623 5:170934237-170934259 AATGGAAAACAAAAAAAGCAGGG - Intronic
1001916427 5:175564466-175564488 GATTTAAAACACTTGAAGCTGGG - Intergenic
1002216697 5:177640071-177640093 AATTAAAAAGAAATAAAACAAGG - Intergenic
1003384101 6:5651518-5651540 GAGTTGCAACAAAAAAAGCAAGG + Intronic
1003734441 6:8862517-8862539 GATTTTTAACACAGAAAGCAGGG - Intergenic
1003873942 6:10420973-10420995 GTTTTAAATCAACTAAAGGATGG - Intergenic
1004420629 6:15466394-15466416 TCTTTAAAAGAAATTAAGCATGG + Intronic
1004506384 6:16250151-16250173 CATTCAAAGCAAATTAAGCATGG + Intronic
1004712061 6:18181000-18181022 AATTTAAAAAACAAAAAGCAAGG - Intronic
1004730509 6:18353777-18353799 TATTTAAAAAAAAAAAAGAAAGG - Intergenic
1004786896 6:18978201-18978223 GTGTAAAAATAAATAAAGCATGG + Intergenic
1004841656 6:19593375-19593397 TATTAAAAAAAAATAAAACAAGG + Intergenic
1004984953 6:21070997-21071019 GATTAAAAACAAATGAAGAAAGG - Intronic
1005047921 6:21659849-21659871 AATTTAAAAGAAAGAAAGAAAGG - Intergenic
1005134501 6:22552258-22552280 GAGTTAAAAGAGATAATGCAGGG - Intergenic
1005183962 6:23142010-23142032 AATTTAATACAAATAAATCATGG - Intergenic
1006041319 6:31258304-31258326 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1006261415 6:32875418-32875440 GATTAAAAAAAAATAATGAATGG - Intergenic
1007869164 6:45013217-45013239 GATGTTAAACAAAGAAAACAAGG - Intronic
1008154317 6:47995110-47995132 TATTTATAATAAATAAAGAAAGG + Intronic
1008410684 6:51175181-51175203 GGTTAAAAACAAATAAATTAAGG + Intergenic
1008557001 6:52682259-52682281 GAATTAAATGAAATAATGCAAGG - Intronic
1008773359 6:55006860-55006882 AATGGAAAGCAAATAAAGCAGGG - Intergenic
1009265873 6:61554259-61554281 GATTTTAAAAAAATGAAACAAGG - Intergenic
1010167871 6:72938742-72938764 TTTTTTAAAAAAATAAAGCATGG + Intronic
1010545502 6:77150505-77150527 TAATTAAAATAAATAAAGAATGG + Intergenic
1011164328 6:84429552-84429574 TATTTAGAACACATAAAACAAGG + Intergenic
1011381087 6:86742952-86742974 TATTTATAACAAATAAATGAGGG - Intergenic
1011382496 6:86758182-86758204 GAGTTAACAAAAAAAAAGCAAGG - Intergenic
1011394704 6:86893754-86893776 AATGGAAAACAAATAAGGCAGGG + Intergenic
1011468847 6:87687845-87687867 GAGTAATAACAAAGAAAGCATGG + Intronic
1011831398 6:91376059-91376081 AAATTAAAACAGATAAATCAAGG - Intergenic
1011972285 6:93241615-93241637 GATTTAAAACCAAAAAAAAAGGG + Exonic
1012557985 6:100539762-100539784 TTTTTAAAAAAAATAAAGAATGG - Intronic
1012870335 6:104665490-104665512 AACTAAAAACAAAAAAAGCAGGG + Intergenic
1012933453 6:105340709-105340731 AATGGAAAACAAAAAAAGCAGGG + Intronic
1013235932 6:108197966-108197988 GGTTTAAGGCAAATAAAGGAAGG - Intergenic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013698637 6:112734634-112734656 TATTTAATATAAATAAACCATGG - Intergenic
1013744662 6:113331507-113331529 GAGGTAAAACAAACAAACCAAGG + Intergenic
1013786217 6:113784458-113784480 GATTGAAAACAATTAAAGGCTGG - Intergenic
1013802142 6:113959324-113959346 TATTTAAAACAATTAATGCTAGG - Intronic
1014111815 6:117626392-117626414 GATTTAAAAAAAATTAATTAAGG + Intergenic
1014325796 6:119991580-119991602 CTTGTAGAACAAATAAAGCAGGG - Intergenic
1014618146 6:123630156-123630178 TATTTAAAAAGAACAAAGCAGGG - Intronic
1015105450 6:129531127-129531149 GATTTAAAGCACATTAAGCCTGG - Intergenic
1015137096 6:129885095-129885117 GATTTAAAACACACATTGCAGGG + Intergenic
1015247288 6:131088639-131088661 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1015424670 6:133051942-133051964 CATATAAAACAAATAAAGTAGGG + Intergenic
1015444195 6:133284905-133284927 GAGAAAAACCAAATAAAGCAGGG + Intronic
1015581798 6:134733299-134733321 GATTTAAAAAAAAAAAAACTGGG + Intergenic
1016195487 6:141332738-141332760 GATATAAAGCAAATAAAGACTGG + Intergenic
1016516555 6:144898903-144898925 TATGTAAATGAAATAAAGCAGGG + Intergenic
1016520463 6:144941110-144941132 AATTCAAAACAAGTAAAGGAAGG + Intergenic
1016711997 6:147184417-147184439 AATTTAAAATAAATAAAACAGGG + Intergenic
1017414950 6:154210013-154210035 GATTTAAAATAAATAAATGAAGG - Intronic
1017883517 6:158579262-158579284 AATTAAAAAAAAAAAAAGCAGGG + Intronic
1018757716 6:166863985-166864007 GATTAAAAACAGACAAAGCCAGG + Intronic
1018776230 6:167018683-167018705 GATTTAAAAAATATAAGGCCAGG - Intronic
1019192526 6:170261433-170261455 GATTTATAAAAAGTAAAACAAGG + Intergenic
1020490445 7:8776751-8776773 AATGAAAAACAAAAAAAGCAGGG - Intergenic
1020553476 7:9638656-9638678 TATTTAAAAAAAAAAAAGTAGGG + Intergenic
1021108704 7:16669426-16669448 GATTTAAAACCAATATTACATGG - Intronic
1021431828 7:20568639-20568661 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1021479351 7:21098820-21098842 CATTTAAAATAAATAAAACATGG - Intergenic
1021616592 7:22508140-22508162 CATTTAAAAAATAGAAAGCATGG + Intronic
1022453799 7:30539787-30539809 AATGGAAAACAAAAAAAGCAGGG + Intronic
1022567699 7:31420034-31420056 AATTTAAAACATAAGAAGCAAGG - Intergenic
1022926395 7:35059353-35059375 CATTTAAAAAATAGAAAGCATGG + Intergenic
1023613456 7:41994494-41994516 AATTTAAAATAAATAAATAAGGG + Intronic
1023673979 7:42611246-42611268 AATTTAAAAATAATAAAGCAGGG - Intergenic
1024379013 7:48672991-48673013 TATATAAAGCAAAAAAAGCAGGG + Intergenic
1024500998 7:50105960-50105982 GTTTTAAAATAGTTAAAGCATGG - Intronic
1024595124 7:50926375-50926397 GATTAAAAAAAAAAAAAGCCTGG - Intergenic
1024887187 7:54157058-54157080 GACTTAATACAGATCAAGCATGG - Intergenic
1024966624 7:55027910-55027932 GATTTGCAACAAATAAAGAGTGG + Intronic
1025154696 7:56594088-56594110 GATTTAAAGCAAATACAGGCAGG + Intergenic
1025763239 7:64414818-64414840 GATTTAAAGCAAATACAGGCAGG - Intergenic
1026050141 7:66939739-66939761 AATATAAAGGAAATAAAGCAGGG + Intronic
1026050157 7:66939877-66939899 AATATAAAGGAAATAAAGCAGGG + Intronic
1027321718 7:77017266-77017288 GCTTTAAAAAAAAAAAAGCCAGG - Intergenic
1027379410 7:77590537-77590559 GATTTAAAAAAAATAGAGATGGG - Intronic
1027857634 7:83533237-83533259 GAATTAAAACAAGCAAAACAGGG + Intronic
1027907919 7:84210244-84210266 AATAAAAAACAAATACAGCATGG + Intronic
1027930426 7:84526274-84526296 GATTTGAAACACATTAAACATGG - Intergenic
1028007935 7:85601191-85601213 GATTTAAAAAAAAAAAGGCATGG + Intergenic
1028121566 7:87060864-87060886 GAGTTAAAAAAAAAAAAGCAAGG - Intergenic
1028375868 7:90146198-90146220 CATTTAAAAAATAGAAAGCATGG - Intergenic
1028392075 7:90328060-90328082 GATTTTCAATAAATAAAGCTGGG + Intergenic
1028449166 7:90961356-90961378 TTTTTAAAAAAAATAAACCAAGG + Intronic
1028719023 7:94007936-94007958 GACTTAAAAGAAAGAGAGCAAGG + Intergenic
1028760904 7:94495396-94495418 CATTAAAAAAAAATAGAGCAAGG + Intergenic
1029824400 7:103174038-103174060 CATTTAAAAAATAGAAAGCATGG + Intergenic
1030683377 7:112455951-112455973 AATTTAAAAGAAAAAAAACAGGG - Intronic
1030770870 7:113473692-113473714 GATTAAAAAAAAAAAAAGAAGGG - Intergenic
1030805217 7:113909452-113909474 GAATTCAAACAAAGAAGGCAGGG + Intronic
1031251984 7:119395606-119395628 GATTCAAAACAATTAAGGTAGGG + Intergenic
1031685121 7:124723976-124723998 GATTTAAAACAAAAAGACCCTGG + Intergenic
1031953833 7:127921981-127922003 TCTTTAAAAAAAACAAAGCAAGG - Intronic
1032136828 7:129286905-129286927 CATTTAAAATAAATAACACATGG - Intronic
1032150560 7:129426051-129426073 CATTTAAAACAACTAATGCCTGG - Intronic
1032327920 7:130949565-130949587 TCTTTAAAAAAAATAAAACACGG - Intergenic
1032488137 7:132303817-132303839 GATTTCACACAAATAATGCCAGG + Intronic
1032768856 7:135027372-135027394 CATTTAAAACAAACAAAAAAAGG - Intronic
1032819499 7:135511241-135511263 GATTTTAAAAACTTAAAGCAGGG + Intergenic
1033911275 7:146266116-146266138 GACTGAGAACAAATAATGCAAGG + Intronic
1034935282 7:155195229-155195251 AATTGAAAACAGAAAAAGCAGGG + Intergenic
1035958604 8:4111917-4111939 AACTTAAAATAAATAAAGTATGG + Intronic
1035972499 8:4265622-4265644 GATTAAAAACAAATATATTAGGG + Intronic
1036849627 8:12192627-12192649 GCTTTAAAGCCAATAAAACAGGG - Intronic
1036870990 8:12434900-12434922 GCTTTAAAGCCAATAAAACAGGG - Intronic
1037245560 8:16830839-16830861 GAATTAAAAAAAAAAAAGGAGGG - Intergenic
1038053562 8:23836546-23836568 AATTTAAAAAAAGGAAAGCAAGG + Intergenic
1038068909 8:23992106-23992128 GGTTTAAAATAAATGCAGCAGGG + Intergenic
1039122676 8:34165941-34165963 AGTTTAAAAGAAATAAAGTAGGG - Intergenic
1039382208 8:37096385-37096407 TATTTACAACACATAAAACAAGG - Intergenic
1039393218 8:37199796-37199818 GATCAAAAACAAATAAGCCAAGG + Intergenic
1039684808 8:39788466-39788488 GACTTAAATTATATAAAGCATGG - Intronic
1039701335 8:39965048-39965070 CAGTTAAATCAAATAAAGCCTGG - Intronic
1039707226 8:40020219-40020241 AATGGAAAACAAATAAAGCAAGG - Intergenic
1039812406 8:41061019-41061041 GATTTAAAAAAAAAAAAAAAAGG - Intergenic
1039982833 8:42422929-42422951 AATTTAAAACAAAATAAGAAGGG - Intronic
1040079348 8:43271815-43271837 GATTTATTACAACTCAAGCAAGG - Intergenic
1040639630 8:49318437-49318459 TATTTAAAACAAGTAAAGTCAGG - Intergenic
1041197855 8:55418885-55418907 TAATTAAAAAAAAAAAAGCAGGG - Intronic
1041294063 8:56336583-56336605 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1041302908 8:56431399-56431421 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1042265317 8:66902391-66902413 AATTTAAAAAAAAAAAAGCCTGG + Intronic
1042643745 8:70962918-70962940 GATTTAAAATGTATAAAGCCAGG + Intergenic
1043053619 8:75409785-75409807 AATTTAAAACAAATAAAAACAGG - Intronic
1043061806 8:75514689-75514711 TTTTTTAAATAAATAAAGCAGGG + Intronic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043200040 8:77356401-77356423 GCTCTAAAACAAAGAAAGGAAGG - Intergenic
1043272060 8:78347044-78347066 AATTAAAAATAGATAAAGCATGG + Intergenic
1043571172 8:81603893-81603915 TTTTTAAAACAAAACAAGCAAGG + Intergenic
1043710325 8:83408526-83408548 GATATAAAATAAAAAAAACAAGG + Intergenic
1044080431 8:87875510-87875532 GATTTAAAAAAATTAAAGTTGGG - Intergenic
1044113521 8:88305113-88305135 AATGGAAAACAAAAAAAGCAGGG + Intronic
1044116982 8:88348055-88348077 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1044253129 8:90027542-90027564 AATGGAAAACAAAAAAAGCAGGG - Intronic
1044548492 8:93485543-93485565 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1044688585 8:94853698-94853720 CATTTAAAACAAATAACTCACGG - Intronic
1044910037 8:97047458-97047480 AGTTTAAAACACATATAGCATGG + Intronic
1045246318 8:100444583-100444605 AATTTAAAAAAAAGAAAGGAGGG + Intergenic
1045395428 8:101756079-101756101 GATTTAAAAAAAAAAAAGGTGGG - Intronic
1046348008 8:112962043-112962065 GATTAAAAACAATTAAATTAAGG - Intronic
1046389464 8:113550622-113550644 GTTTTAAGAAGAATAAAGCAAGG - Intergenic
1046531850 8:115456294-115456316 AATTTAAAGCAAATAATTCAGGG - Intronic
1046541900 8:115594883-115594905 CATTTAAAAGAAAAAAAACAAGG - Intronic
1046813236 8:118555280-118555302 GATTTAAAGAAAACAAAGAACGG - Intronic
1047290905 8:123529830-123529852 CTTTTACAAGAAATAAAGCAAGG - Intronic
1047437123 8:124843965-124843987 TATATAAAACAGATACAGCAGGG + Intergenic
1047458214 8:125036357-125036379 GATTTAAAATCAACAAAGTATGG - Intronic
1048149585 8:131881523-131881545 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1048743867 8:137591756-137591778 GATTTAGAAAAAAAAAAGCAAGG - Intergenic
1048856371 8:138689724-138689746 AAATAAAAATAAATAAAGCAGGG + Intronic
1049304379 8:141892921-141892943 GAGTGAAAACAAGTAAGGCATGG + Intergenic
1050471906 9:6001975-6001997 GGTTTAAAACAAATAATGGGAGG - Intronic
1051277177 9:15407735-15407757 AATTTAAAAAAAAAAAAGAATGG + Intergenic
1051379334 9:16439365-16439387 GATTTATAAAAAATGAAGAATGG + Intronic
1051773903 9:20613582-20613604 TAATTAAAAAAAAAAAAGCATGG - Intronic
1052258593 9:26489199-26489221 GAATAAAAATCAATAAAGCATGG - Intergenic
1052454142 9:28672705-28672727 CATTTCAAACAAATAGATCATGG - Intergenic
1053811737 9:41860281-41860303 GATTTTAACCAAAGAAAACAGGG - Intergenic
1054618857 9:67327158-67327180 GATTTTAACCAAAGAAAACAGGG + Intergenic
1054891676 9:70258741-70258763 GAGTTAAAACAAAAAAAAAAAGG + Intergenic
1054898006 9:70335982-70336004 AATCTACAACAAATACAGCAAGG - Intronic
1054983392 9:71233270-71233292 GCTTTAAAAATAATGAAGCATGG - Intronic
1055046321 9:71928960-71928982 GCTTTAAACCAAATGAATCATGG + Intronic
1055808036 9:80118498-80118520 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1056111050 9:83395271-83395293 GATTTAAAAAAAAAAAAAAAAGG + Intronic
1056700048 9:88895853-88895875 GTCTTAAAACAAATAAATAATGG - Intergenic
1056992826 9:91426446-91426468 TATTTGAAACAAATTAACCAGGG + Intergenic
1057098321 9:92332802-92332824 CATTTAAAACAAAAAAAAAAAGG + Intronic
1057252758 9:93516902-93516924 TGTTTAAAACAAAAAAAACAGGG + Intronic
1057356747 9:94338264-94338286 GGTCTAAAACAAATACACCAAGG - Intergenic
1057651006 9:96919380-96919402 GGTCTAAAACAAATACACCAAGG + Intronic
1058209936 9:102154261-102154283 GATTTAAAAAAAAAAAAAAAGGG - Intergenic
1058241303 9:102564627-102564649 GATTTAAAACAAATAGAACTGGG - Intergenic
1058823751 9:108756426-108756448 GATTTAAGAAAAACAAGGCAAGG - Intergenic
1059102149 9:111482566-111482588 GTTTTAAATGGAATAAAGCATGG - Intronic
1059991970 9:119874173-119874195 GCTTTAAAGCAAATAAAGAAGGG - Intergenic
1060000905 9:119957904-119957926 GAGTTAAATGAAATAACGCACGG + Intergenic
1060181231 9:121535441-121535463 GATTGGAAACAAGTAAAGCCAGG + Intergenic
1060610029 9:124955402-124955424 AATTTAAAATAAATAAGGCCGGG + Intronic
1060709852 9:125849362-125849384 GATTTAAAAAAAAAAAAGGAAGG + Intronic
1060810129 9:126607109-126607131 ATTTTAAAGCAAATAAATCAAGG + Intergenic
1060814753 9:126628990-126629012 GATTAAAAAAAAAAAAAGCAGGG + Intronic
1061021890 9:128021006-128021028 GCTTTGAAAAAAATAAAGTAGGG - Intergenic
1061552161 9:131343201-131343223 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1062634519 9:137483415-137483437 ATTTTAAAACACATAAAGCATGG - Intronic
1203756218 Un_GL000218v1:129423-129445 GATGTAAAACTTACAAAGCAGGG - Intergenic
1185502734 X:610763-610785 AATTTAAAAAAAAAAAAACAAGG - Intergenic
1186145616 X:6621540-6621562 GATTTAAAAGAGAGAAAGGAAGG + Intergenic
1186173130 X:6898529-6898551 CTTTTTAAACAACTAAAGCAGGG + Intergenic
1186249240 X:7648158-7648180 GATTTAAAAAAAAAAAATCCTGG + Intergenic
1186683836 X:11903539-11903561 GACTTCAAACAAATAAAGCATGG - Intergenic
1186686023 X:11925068-11925090 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1187020435 X:15375883-15375905 GATTTCAAACACATAAAGGCAGG - Intronic
1187280355 X:17853968-17853990 GTTTTAAAAAAACTAAAACAAGG + Intronic
1187655534 X:21467457-21467479 GTGTTAAAACAAATCAAGAAAGG - Intronic
1187786352 X:22891652-22891674 GATTTAAAAAAAAAAAAAAAAGG + Intergenic
1188869323 X:35354463-35354485 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1189189043 X:39080908-39080930 CATTGAAAACAGAAAAAGCAGGG - Intergenic
1189609132 X:42713503-42713525 GCTTTAAGACAAATAATGAATGG + Intergenic
1190222060 X:48518201-48518223 TATTTAAATTAAATAAAACAGGG - Intronic
1190367498 X:49710078-49710100 CAATTAAAACAAAGAAAGAATGG + Intergenic
1190419002 X:50209081-50209103 TTTTTAAAAGAAATAAAACAAGG - Intronic
1190419421 X:50213849-50213871 TTTTTAAAAGAAATAAAACAGGG - Intronic
1190420149 X:50222089-50222111 AATTAAAAGCAAAAAAAGCAGGG - Intronic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1191576528 X:62712663-62712685 GCTTTTAAAGAAGTAAAGCAAGG + Intergenic
1191816028 X:65245919-65245941 TATTTAAAAAAAAAAAAGAAAGG + Intergenic
1191998162 X:67119274-67119296 GATTCATATCAAATAAGGCATGG + Intergenic
1192102821 X:68283135-68283157 AATGTAAAACAAATTAATCATGG + Intronic
1192205631 X:69094182-69094204 AATTTCAAACAAGCAAAGCATGG + Intergenic
1192403995 X:70865214-70865236 AATGGAAAACAAAAAAAGCAGGG + Intronic
1192856371 X:75017055-75017077 GATTTAAAACAAAAAATTCATGG - Intergenic
1192915825 X:75650269-75650291 AAGTTAAAAAAAAAAAAGCAGGG - Intergenic
1193324045 X:80158354-80158376 AATTAAAAACAAATAAAGATTGG + Intergenic
1193381910 X:80826001-80826023 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1193476019 X:81966768-81966790 GGTTTAAAAATAATAAATCAAGG + Intergenic
1193528323 X:82620897-82620919 AATGGAAAACAAAAAAAGCAAGG + Intergenic
1193583102 X:83288597-83288619 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1193592709 X:83409382-83409404 AATGTAAAACAAAAAAGGCAGGG + Intergenic
1193648404 X:84097607-84097629 AAATTAAAAAACATAAAGCAAGG - Intronic
1194281134 X:91956010-91956032 GATTTAAAAAAGACAAAGAAGGG - Intronic
1194485769 X:94484398-94484420 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1194830410 X:98617012-98617034 GATTTTAAAAAGATAAAGGAGGG - Intergenic
1195033379 X:100948383-100948405 GATGTAAAAACAATCAAGCATGG + Intergenic
1195122403 X:101768591-101768613 GATTTAAAAAAAAAAAAAAAAGG - Intergenic
1195381703 X:104277351-104277373 GACGTACAAAAAATAAAGCAAGG + Intergenic
1195781902 X:108476234-108476256 AATTTAAAATAAATAAATCAAGG - Intronic
1195855997 X:109333644-109333666 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1196388214 X:115182263-115182285 AATTAAAAACAAATAAATTACGG + Intronic
1196970553 X:121103634-121103656 GAGATAAATCAAATACAGCATGG - Intergenic
1197122585 X:122909179-122909201 AATTGAGAACAAAAAAAGCAGGG + Intergenic
1197144095 X:123151945-123151967 AAATGAAAACAAATAGAGCAAGG + Intergenic
1197515858 X:127427734-127427756 TATTTAAAAAAAATAAATGAAGG + Intergenic
1197814750 X:130485787-130485809 CATATAAACCAAATAAAACATGG - Intergenic
1197850363 X:130852490-130852512 GATATAAAGAAAATAAAGCAGGG + Intronic
1198003271 X:132463063-132463085 GATTTAAAACATTTAAAGTTTGG + Intronic
1198675179 X:139123591-139123613 GCTTTAAAAGAAAAAAAGAAGGG - Intronic
1199147348 X:144384056-144384078 TATTTGAAACATATACAGCAGGG - Intergenic
1200421831 Y:2977809-2977831 GAATAAAAATAAATAAAGTAAGG + Intronic
1200598726 Y:5180674-5180696 GATTTAAAAAAGACAAAGAAGGG - Intronic
1200810285 Y:7477635-7477657 AATAGAAAACAAAAAAAGCAGGG - Intergenic
1200934790 Y:8728896-8728918 GATTGAAAAAAAAAAAAGAAAGG + Intergenic
1201370924 Y:13263653-13263675 AATTTAAAAAATATAAAGGAAGG + Intronic
1201387663 Y:13460388-13460410 TATTTAAAAGAAGTGAAGCAAGG - Intronic
1201737907 Y:17289715-17289737 GAATTAAAAAAAAAAAGGCAGGG + Intergenic
1201778587 Y:17693909-17693931 AATGGAAAACAAAAAAAGCAGGG - Intergenic
1201822969 Y:18212083-18212105 AATGGAAAACAAAAAAAGCAGGG + Intergenic
1201922407 Y:19247656-19247678 GATTTAAAAAACACAAAGAAAGG + Intergenic