ID: 1190935586

View in Genome Browser
Species Human (GRCh38)
Location X:54996514-54996536
Sequence AAAGTCTTAAAGGGTAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190935586 Original CRISPR AAAGTCTTAAAGGGTAAACC TGG Intronic
900883058 1:5395820-5395842 AAAGGCTTAAAGCTCAAACCTGG - Intergenic
901619833 1:10574949-10574971 AAATTCGTAAAAGATAAACCAGG + Intronic
905452646 1:38066759-38066781 AAGATCTTAAAGGATAACCCTGG - Intergenic
906134911 1:43491857-43491879 AAAGGCTTAAAAGGAAAAGCTGG - Intergenic
906837463 1:49099374-49099396 AAAGTCATGAAGTGTAAATCTGG + Intronic
907995929 1:59632772-59632794 AAAGTCATAAAGGCTAAAAGGGG - Intronic
908827368 1:68146625-68146647 AAAGTCTTAAAGTGAAACCAGGG + Intronic
909363182 1:74789055-74789077 AAAGTCTTAAAAGCTAAAGAAGG + Intergenic
909534763 1:76724150-76724172 AAAGGCTTAAAGAGGGAACCAGG - Intergenic
910371506 1:86521143-86521165 AAAGTCTTGATGGATAAACAAGG + Intergenic
911872439 1:103116204-103116226 AAAATCTTAGAGGTTAAAACAGG + Intergenic
912144704 1:106779004-106779026 AAAGTCTTAAGGGGAAAAAAGGG - Intergenic
913718133 1:121560107-121560129 AAAGTCTTAAAAGGTCAACAGGG + Intergenic
914741651 1:150470968-150470990 AACTTCTTAAAAGGTAATCCTGG + Exonic
918778379 1:188666801-188666823 TAAGTCTAAAACAGTAAACCAGG - Intergenic
919392269 1:197001897-197001919 AAAGTTTTAAATGGTCAACTTGG - Intronic
919836896 1:201581125-201581147 AAAGCCTTTAAGGGTAAGCATGG - Intergenic
921664846 1:217856397-217856419 AAAGTCCTTAAAGATAAACCTGG + Intronic
922135988 1:222826682-222826704 AAATTCTTAAAGTGTAGGCCAGG - Intergenic
924169524 1:241323509-241323531 CAAGTATTAAAGGATAAACTGGG + Intronic
924481054 1:244434546-244434568 AATGTGCTAAAAGGTAAACCTGG + Intronic
1065554509 10:26901680-26901702 AAAGACTTAAACGTAAAACCTGG - Intergenic
1066453557 10:35553015-35553037 AAAGTCTTTCAAGGTACACCTGG - Exonic
1070960321 10:80494868-80494890 AAATTCATAAAGGCTAAACAAGG + Intronic
1073840102 10:107488898-107488920 AAAATCTTAATGGGAGAACCAGG - Intergenic
1076078204 10:127554481-127554503 AAAGTATTGAAGGGTATATCTGG - Intergenic
1078564285 11:12400961-12400983 AAAGTCTTCAAGGGAAATACAGG - Intronic
1080422413 11:32122609-32122631 ACAATCTTAAAGGGTAAATGTGG + Intergenic
1081497710 11:43632118-43632140 AAACTCCTAAATCGTAAACCAGG - Intronic
1085242487 11:75070220-75070242 AAAGTGTTAAGGGGGAACCCAGG - Intergenic
1086471032 11:87110481-87110503 AAGCTATTAAATGGTAAACCAGG - Intronic
1087554428 11:99697026-99697048 AAACTCTTAAAGGCCAAAGCTGG + Intronic
1088352531 11:108906144-108906166 AAAGTACTACATGGTAAACCAGG - Intronic
1089879870 11:121763117-121763139 TGAGTCTTAAAGAGCAAACCTGG + Intergenic
1092225917 12:6748358-6748380 GAAGTCATCAATGGTAAACCAGG + Exonic
1092488100 12:8920297-8920319 AAAGTTTTAAAAAGTAAAACAGG - Intronic
1094060329 12:26308242-26308264 AAAGCCTTAAAGGTAAGACCTGG + Intergenic
1094148172 12:27252520-27252542 AAAGTCGTAAGGGGCAAACACGG - Intronic
1094441278 12:30479760-30479782 AAAGCCTTAAAGTCAAAACCTGG - Intergenic
1097320870 12:58224782-58224804 AAGTCCTTAACGGGTAAACCAGG + Intergenic
1098821033 12:75229630-75229652 ACAGGCTTAAAGGGAAAAACAGG - Intergenic
1100284561 12:93152972-93152994 AAAGCCTTAAATGGTATGCCAGG - Intergenic
1101486426 12:105166692-105166714 AAAATTTTAAAGTGTAAACAAGG + Intronic
1102003154 12:109571077-109571099 ATAGTCTGAAAGGTTACACCTGG - Intronic
1102935428 12:116892472-116892494 AAAGTGTTAAATGGTAATTCTGG - Intergenic
1108295484 13:49013018-49013040 AAGATCTAAAAGGGTAAGCCAGG + Intronic
1108702411 13:52954983-52955005 GAAGTCGTAAAGGTTAAATCAGG + Intergenic
1110216425 13:73029627-73029649 AAAGTATTAGAGGGAAAGCCAGG + Intergenic
1111217557 13:85163837-85163859 AAAGTCTTCAAGGGGTGACCTGG - Intergenic
1112522913 13:100113872-100113894 AAAGAGTCAAAGAGTAAACCGGG - Intronic
1113007036 13:105717852-105717874 AAAGTCTTATTGTTTAAACCAGG + Intergenic
1117560346 14:56931532-56931554 AATGTGTGAAAGGGTAAACATGG - Intergenic
1117809631 14:59532918-59532940 AAAGTTTTTAAGAGTAAACTGGG - Intronic
1119012252 14:71005345-71005367 AAAGTTTTAAAAAGTAAGCCAGG + Intronic
1120525634 14:85573836-85573858 AAAGTCTTAAAACTTAAAGCAGG - Intronic
1123874956 15:24614752-24614774 ACTGTCTTTAAGGGTCAACCAGG + Intergenic
1125210290 15:37206907-37206929 AAAGGCCTAGATGGTAAACCTGG - Intergenic
1125437572 15:39663774-39663796 AAAGTCTCAAAGGGACAACTAGG + Intronic
1126943353 15:53790112-53790134 AAATTGCTAAAGGGTAAACGAGG + Intergenic
1128994097 15:72284265-72284287 AAAGTCTTCAAGGATGAACTGGG - Intronic
1130609903 15:85351589-85351611 ACAGTTTGAAAGGGAAAACCAGG - Intergenic
1131988241 15:98066431-98066453 GAAGACTTACAGGGTGAACCTGG - Intergenic
1137283202 16:46995475-46995497 CCAGTCTCAAAGGGTAAAACAGG + Intergenic
1137308453 16:47229451-47229473 TAAGGCTGAAGGGGTAAACCAGG + Intronic
1140159587 16:72474329-72474351 AAAGTCTTAAAATCTAAGCCTGG + Intergenic
1140800727 16:78485886-78485908 AAAGGCCTAAAGGGCAAGCCAGG + Intronic
1145216260 17:21054796-21054818 AGAGCCTTGAAGGGTAAACAGGG + Intergenic
1149244531 17:54690009-54690031 GAAGTCTGAAGGGGTAAAGCTGG + Intergenic
1149318000 17:55457103-55457125 AAAGGATAAAAGGATAAACCAGG + Intergenic
1150070019 17:62142313-62142335 AAAGGTTAAAATGGTAAACCTGG - Intergenic
1150822908 17:68450175-68450197 AAAGTCTTCAAGGGTTAGCTGGG + Intronic
1157015218 18:43703994-43704016 AAAGACTAAAGGGGAAAACCTGG - Intergenic
1158121457 18:54052839-54052861 AAAGTTTTCAAGGGTAACCTGGG + Intergenic
1161226181 19:3147018-3147040 AAAATCTTAGAGGGCACACCAGG - Intronic
1162232068 19:9275457-9275479 CAAGTCTAAAATGGTAAACAGGG + Intergenic
1164655682 19:29919735-29919757 AAAGTTTAAAAGGGTCAGCCAGG - Intergenic
1165601373 19:37057899-37057921 ACAGTCTTAAAGAGGAAGCCAGG + Intronic
926127715 2:10282185-10282207 ATAGTCATCAAGGGTACACCAGG - Intergenic
927491843 2:23526073-23526095 AAAGGCTGAAAGGGAAAAGCAGG + Intronic
928248877 2:29657156-29657178 AAAGTCTTAAAGGAGTAACAAGG + Intronic
929771290 2:44894372-44894394 AAAGTCTTAATGGGAAAAAAAGG + Intergenic
930178694 2:48328174-48328196 AAAGTCCTAAAGGACAAATCTGG - Intronic
930809018 2:55521004-55521026 GAAGTCTTAAAAGGTCATCCAGG - Intronic
931592551 2:63901388-63901410 AAATTCTTAAAGGCCAAACGTGG + Intronic
932685474 2:73865542-73865564 AAAGCCTTAAATGTTCAACCTGG - Exonic
932708028 2:74041892-74041914 AAAATCTAAAAGGGTAAACAGGG - Intronic
934484444 2:94690693-94690715 AAATTCTTAAAGGCTAAATGTGG + Intergenic
934763406 2:96868397-96868419 AAAGCCCCAAAGGGGAAACCTGG + Intronic
937831265 2:126426634-126426656 AAAGTCTTCAAGTATAAAGCTGG + Intergenic
939219247 2:139281094-139281116 AAAGTGTCAAAGGGTAAAAGGGG + Intergenic
940444143 2:153756689-153756711 ACATTCTAAAATGGTAAACCTGG - Intergenic
940843606 2:158614722-158614744 AAAATATTAAAGGCTAAAACTGG - Intronic
942198739 2:173549685-173549707 AAAGTATTAAAGTGTACATCAGG - Intergenic
943382152 2:187164146-187164168 AAAGTATTAAATGATAAAACAGG + Intergenic
944094341 2:195949577-195949599 AAAGAAATAAAGGGTAAGCCAGG - Intronic
945444832 2:209924681-209924703 AAAATCTTAAAAGGCAAATCTGG - Intronic
946479033 2:220035887-220035909 AAAGTCCTAAGAGATAAACCTGG - Intergenic
1169848645 20:10025284-10025306 AAAGCCTGAAGGTGTAAACCAGG + Intronic
1171337759 20:24400889-24400911 AAATTATGAAAGGGAAAACCAGG + Intergenic
1171399358 20:24862099-24862121 AAATTTTTAAAGGGTAGCCCAGG + Intergenic
1174416165 20:50368629-50368651 AAAGTCTAAAGGGCTTAACCTGG + Intergenic
1179833985 21:44016556-44016578 AAACTTTTAAAGGGGAAAACAGG + Intronic
1182673248 22:32015798-32015820 ATAGTCCTAAAGAGTAGACCAGG - Intergenic
1183565833 22:38614649-38614671 GAAGTTTTAATGGGCAAACCAGG - Intronic
950748800 3:15112487-15112509 ACCGGCTTTAAGGGTAAACCAGG + Intergenic
952522491 3:34175178-34175200 AAAGTCATAAATGGCATACCTGG + Intergenic
955505473 3:59628706-59628728 AAAGACTTAAATGTTAGACCTGG + Intergenic
956784433 3:72630603-72630625 AGGGCCTTAAAGGTTAAACCTGG + Intergenic
960575130 3:119221638-119221660 AAAATCATAAATGATAAACCAGG + Intronic
962285150 3:134079017-134079039 AATGTCTTAAAGTGAAAACAGGG - Intronic
962793534 3:138832380-138832402 AAAATCTTAAAGGTTTAAACTGG - Intronic
966190346 3:177266761-177266783 AAAAATTTCAAGGGTAAACCAGG - Intergenic
971384377 4:26129674-26129696 AAAGTCTTCAACTGTAAACTAGG - Intergenic
974391160 4:61270774-61270796 AAAGTCATAAAGAGAAAATCAGG - Intronic
974425564 4:61738548-61738570 AAAGTCTGAAATGGTAACCTTGG + Intronic
974903051 4:68024424-68024446 AAACTCTTAAAAGGTAAATGTGG - Intergenic
976653786 4:87465191-87465213 AAAGTATTAAAGGGCAGACATGG + Intergenic
976876434 4:89858710-89858732 AAATTGTAAAAGGGTAAAGCCGG + Intergenic
976960462 4:90965232-90965254 AAAATCTTAAATGGAAAATCTGG + Intronic
978073206 4:104495538-104495560 AAAGTCTTCCTGGGTACACCAGG - Intergenic
978451400 4:108838132-108838154 AAAGGATTGAAGGGTGAACCAGG - Intronic
979099112 4:116592741-116592763 AAAGTCTTAAAGGAAAAATTAGG + Intergenic
979214662 4:118148884-118148906 AAAGACTTAAACGTTAGACCAGG - Intronic
980164036 4:129202870-129202892 AAAGTTTTAAATGTAAAACCAGG - Intergenic
980652144 4:135731876-135731898 AAAGTGCTAAAGGGTAAATGAGG + Intergenic
980875971 4:138662474-138662496 AAAGTCCTCAAGGGCAAAGCAGG - Intergenic
981292677 4:143094586-143094608 AATGTCTTAAAGGATAAATTAGG - Intergenic
982412468 4:155094497-155094519 AAAGTCTCAAAGGCAAAACTTGG - Intergenic
983143517 4:164184149-164184171 AAACTCATAAAGTGTAAAGCTGG + Intronic
984741705 4:183170545-183170567 AAAGTCCTGAAGGTGAAACCTGG + Intronic
984828921 4:183953371-183953393 AAAGTGGTAAAGGGGCAACCAGG - Intronic
987138744 5:14923505-14923527 AAAGTACTAAAGAGTACACCAGG - Intergenic
989960429 5:50407744-50407766 AAAGTCTTAAAAGGTCGACAGGG - Intronic
990630803 5:57666851-57666873 AAAGTCTTAAAGTTTCAACTTGG - Intergenic
991325618 5:65428524-65428546 AAAGACTTCAAGGAAAAACCAGG + Intronic
995407445 5:111815152-111815174 ACAGTCTTAAAGGCTAAAAGAGG + Intronic
998298787 5:140998414-140998436 ATAGTGTTAAAGGATAAACCAGG - Intronic
998940135 5:147272607-147272629 AATCTCTTAAAGGGTACACAAGG + Intronic
1003301262 6:4884897-4884919 GAAAGCTTAAAGGGTAAACGGGG - Intronic
1006279360 6:33036383-33036405 AAAAGCTTAAAGGGAAAATCTGG - Intergenic
1008331458 6:50249965-50249987 AAAGTCTTAAGGGTTCAAGCAGG + Intergenic
1008449792 6:51637242-51637264 TATGTCTTAAAGGGTAAGACAGG - Intronic
1009594874 6:65722086-65722108 AATGTGGTAAAGGGTAAAGCAGG - Intergenic
1011133310 6:84073680-84073702 AAAGTCTCAATAAGTAAACCTGG - Intronic
1011847478 6:91584347-91584369 AAAGTCTTGATGGGAAAAACTGG + Intergenic
1012661830 6:101907861-101907883 AATGTCTTAAAGGATAAATGAGG - Intronic
1013281636 6:108643273-108643295 AAAGTCTGAAAAGGTCAAACTGG - Intronic
1013998804 6:116341622-116341644 AAAGACTTAAATGTTAGACCTGG - Intronic
1014485500 6:121994154-121994176 AAAGTCTGAAAGGGTGTACCGGG + Intergenic
1014640576 6:123904497-123904519 AAAGTCTGAGAGGGTAACCCGGG - Intronic
1014966874 6:127765028-127765050 AAAGTCTCAACGGGTATCCCTGG - Intronic
1015277118 6:131394870-131394892 AAAATCTTAAAAGGAAAAACTGG - Intergenic
1016168990 6:140984888-140984910 AAAGTACTAAAGTGAAAACCTGG - Intergenic
1017153641 6:151303717-151303739 AATGACTTAAAGGGTATTCCAGG - Intronic
1025040626 7:55641446-55641468 GAAGTCCTAAAGGGAATACCAGG + Intergenic
1030416882 7:109256268-109256290 AAAATCTTAAAGGTTTACCCAGG - Intergenic
1030947425 7:115740997-115741019 AAAATTTTAAAAGGAAAACCTGG + Intergenic
1030975846 7:116122173-116122195 AAAGGCTTAAAGTGCAAACAGGG - Intronic
1030979433 7:116168864-116168886 AAAGTTTAAAAGGATAAACAGGG + Intergenic
1032284427 7:130530150-130530172 GAAGTCTTAAACTGTAAACATGG + Intronic
1032729029 7:134619157-134619179 CAAGTCTTGAAGGATAAGCCAGG - Intergenic
1032936349 7:136736786-136736808 AAAGTATTACATGGTAAGCCTGG - Intergenic
1033019021 7:137702933-137702955 AAAATCTTAAAAGGAAAAACTGG + Intronic
1036056810 8:5263916-5263938 AAAGTATTAAAAGGAAAACACGG + Intergenic
1037447107 8:18976601-18976623 AATGTCTTCAAAGGTAAAACAGG + Intronic
1041624829 8:60013730-60013752 AAAGACTCAAAGGCTACACCTGG - Intergenic
1044718983 8:95127762-95127784 AAAATGTTAATGGGTAAATCTGG - Intergenic
1046241478 8:111501204-111501226 TAAGTCTTACAATGTAAACCTGG - Intergenic
1048184284 8:132225305-132225327 AAAGTATTCAAGGGAAAATCAGG + Intronic
1053305772 9:36983819-36983841 ATAGTCTTGAAGGGTAGAACTGG - Intronic
1053673351 9:40393705-40393727 AAATTCTTAAAGGCTAAATGTGG - Intergenic
1053923156 9:43020065-43020087 AAATTCTTAAAGGCTAAATGTGG - Intergenic
1054384455 9:64533770-64533792 AAATTCTTAAAGGCTAAATGTGG - Intergenic
1054511276 9:65982583-65982605 AAATTCTTAAAGGCTAAATGTGG + Intergenic
1055816393 9:80212273-80212295 AAAGTCTTAAAGTGAAAAGATGG + Intergenic
1056490385 9:87100939-87100961 AAAGTATAAAAGGTTAAGCCTGG - Intergenic
1057588266 9:96348774-96348796 ACAATCTAAAAGGGTAAATCGGG - Intronic
1058372199 9:104282687-104282709 AAAGTATTGAAGGGTTAATCAGG - Intergenic
1060165241 9:121408148-121408170 GAAGTCTAAAAGTGTTAACCGGG + Intergenic
1186699941 X:12079488-12079510 AAAGTCTTAAAGTGTAAAAATGG - Intergenic
1188368179 X:29335422-29335444 ATAGATTTAAAGGTTAAACCTGG + Intronic
1189828827 X:44949441-44949463 AAAGTCTGAAAGGGTATATTCGG + Intronic
1190530908 X:51375126-51375148 AAAATCTTAAAGAGTATACTTGG + Intergenic
1190620119 X:52278882-52278904 ACAGGCTTTAAGGGTCAACCAGG - Intergenic
1190935586 X:54996514-54996536 AAAGTCTTAAAGGGTAAACCTGG + Intronic
1191815804 X:65242989-65243011 AAAGACTTAAATGTAAAACCAGG + Intergenic
1195164535 X:102205997-102206019 AAAAGCTTAAAAGGTAAAACTGG - Intergenic
1195194324 X:102481097-102481119 AAAAGCTTAAAAGGTAAAACTGG + Intergenic
1196347123 X:114676158-114676180 AAAGTCTTAAAGGCTGAGCGCGG - Intronic
1197908545 X:131454299-131454321 AAAGTCTTAAAAGGAAAAACTGG - Intergenic
1198047778 X:132919858-132919880 GAAATCTTAAAGGGTAAATCAGG - Intronic