ID: 1190937780

View in Genome Browser
Species Human (GRCh38)
Location X:55012288-55012310
Sequence TTGGAGAGGCTTTGTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190937780 Original CRISPR TTGGAGAGGCTTTGTGAGTA AGG (reversed) Intronic
900137538 1:1124730-1124752 TTGCAGAGTCTCTGTGAGTCAGG + Intergenic
900686348 1:3950511-3950533 TTGGGGAGGCTGTGTGTGTGGGG + Intergenic
901437698 1:9258091-9258113 GTGCAGGGTCTTTGTGAGTATGG + Intronic
902860071 1:19238976-19238998 TTGAATAGGCTTTGTGGGCAGGG - Intronic
903827478 1:26156376-26156398 TTGGATCGGCTTTCTGGGTAAGG - Intergenic
904332292 1:29767915-29767937 TTGGAGAGATCGTGTGAGTAAGG + Intergenic
906876837 1:49548340-49548362 TTGAAGAGGATTTGTGAGAGTGG + Intronic
907407954 1:54265284-54265306 TTGGAGAGGGGTTGTGTGAAGGG + Intronic
907773515 1:57489524-57489546 TGAGGGAGGCTTTGTGAGCATGG - Intronic
908002567 1:59694898-59694920 TTGGATAGGCATAGAGAGTATGG + Intronic
908238106 1:62166785-62166807 TGGGAGAGGCTGTGTGAGTGAGG - Intergenic
912522335 1:110254186-110254208 CTGGAGATGCTTTGTCAGAAAGG + Intronic
913070303 1:115292560-115292582 TTGGAGAGGCTAAGTGACTTGGG + Intronic
915839301 1:159202200-159202222 TTGGGGAGGCTTTGGGAATGGGG + Intronic
920084872 1:203408004-203408026 TTGGGGAGGCTGTGTGTGTGAGG - Intergenic
920663357 1:207938938-207938960 TTGGTGAGGCTCTGAGAGTGAGG + Intergenic
923044479 1:230345473-230345495 TTGCAGAGGGCTTGTGAGCATGG - Intronic
924645467 1:245873373-245873395 TTGGGTAGGAGTTGTGAGTATGG - Intronic
1062898556 10:1124057-1124079 GTGGAGAGGCTTTGGGAGGCGGG + Intronic
1063721273 10:8584082-8584104 TTGGGGAGGCTGTGGGTGTAGGG + Intergenic
1064419816 10:15180983-15181005 TTTGTGAGCCTTTGAGAGTATGG - Intergenic
1070126831 10:73629251-73629273 ATGGTGAGACTTTGTGAGCATGG + Intergenic
1071490942 10:86135870-86135892 TTGGCTAGGCTTTTTGAGTAGGG + Intronic
1074204226 10:111268199-111268221 TTGGAGATACTTTGTGAGGAGGG + Intergenic
1076520251 10:131076757-131076779 TGGGACAGGCTGTGTGAGTTAGG + Intergenic
1078497785 11:11837610-11837632 GTGGAGAGGGTGTGTGTGTAGGG + Intergenic
1081671683 11:44945988-44946010 CTGGAGAGGCTTAGGGACTAAGG + Intronic
1081795043 11:45813053-45813075 CTGGAGAGGATTTGTGAACAGGG + Intergenic
1082610863 11:55295584-55295606 TTGGAGAGGCTGTGAAAGGAGGG - Intergenic
1082795687 11:57376514-57376536 GTGGAGATGGTTTGGGAGTAGGG - Intergenic
1083116597 11:60465814-60465836 TTGTAGTTGCTTTGTGAGTCAGG + Intronic
1089264244 11:117246920-117246942 ATTGAGAAGCTTTGTGAGAAGGG + Exonic
1090274353 11:125409185-125409207 TTGGAGAGAATTTGTGAGGAAGG - Intronic
1091356667 11:134942832-134942854 CGGAAGAGGCTTTGTGAGCATGG - Intergenic
1092556804 12:9568829-9568851 TGGGAAAGGCTTTGTCAGTTCGG + Intergenic
1094218388 12:27969596-27969618 TTGAAGAGGCTTTTTGAGAGCGG - Intronic
1095688396 12:45061309-45061331 TCAGAGAGACTTTGTGAGGAGGG + Intergenic
1096992526 12:55816983-55817005 TTGGAGATGGTGTGTGAGGAAGG + Intronic
1097965156 12:65571239-65571261 TTGCAGTGGCTTTGTGATCAAGG - Intergenic
1099501926 12:83424056-83424078 TTGGGGAGGTTTTGTGGGGAGGG - Intergenic
1100618309 12:96248625-96248647 ATGGACAGGCTTTGTGAGCTGGG + Intronic
1101720705 12:107348117-107348139 ATGGGGAGACTTTCTGAGTAAGG - Intronic
1103007551 12:117433945-117433967 TGTGAGAGGGTTTGTGTGTATGG - Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1104237694 12:126955076-126955098 ATGGAGAGGGTGTGTGTGTACGG + Intergenic
1109641156 13:65193256-65193278 TTGGAGAGGCCATGTGAAAAAGG + Intergenic
1112198644 13:97252391-97252413 TTGGGGAGGCTGTATGGGTATGG - Intronic
1114293057 14:21304660-21304682 TTGGGGAGGCTGTGTGTGTATGG - Intronic
1116055531 14:39859679-39859701 GTGGAGAGGCTGTGTGAGAATGG + Intergenic
1116368838 14:44104479-44104501 TTGGTGAGGCTTTGTCACTGTGG + Intergenic
1117815223 14:59590847-59590869 TTGGAGAGGCACTGTGGGTGAGG + Intergenic
1119889771 14:78174065-78174087 TTGGAGAGTCTTTGTGGGAGGGG + Intergenic
1120173285 14:81268196-81268218 TTGGAGAGGCTCTTTGATTCTGG - Intronic
1120932318 14:89861236-89861258 ATGGAGAGCCTAGGTGAGTAGGG - Intronic
1121039483 14:90733532-90733554 TTGGAGGCTCTTTGTGAGGAAGG - Intronic
1124189014 15:27555212-27555234 TTGGGAAGGCTTTGGGAGTGTGG - Intergenic
1125278218 15:38016136-38016158 TGGGGGAGGCTATGTGTGTATGG + Intergenic
1125306035 15:38315753-38315775 ATGAAGAGGATTTTTGAGTATGG - Intronic
1127079150 15:55358640-55358662 TTGGAAAGGCTTCTTGAGTGAGG - Intronic
1128305064 15:66593033-66593055 CTGGAGAGGATATGTGAGTTGGG - Intronic
1129647455 15:77449725-77449747 TTGGGGAGGCTGTGTGTGTGGGG - Intronic
1130005165 15:80089204-80089226 TGTGAGATCCTTTGTGAGTAGGG + Intronic
1130263500 15:82378199-82378221 GTAGAGAGGCTTTGTGACTAGGG + Intergenic
1137719999 16:50622241-50622263 TTGGTGAGGCTCTGAGCGTAGGG + Intronic
1138448643 16:57079774-57079796 TTTGAGAGGATGTCTGAGTAAGG - Intronic
1141375712 16:83528109-83528131 TTAAAGAGGCTGTGTGAGTTTGG - Intronic
1143406547 17:6681506-6681528 TTTCAGAGGCTGTGTGACTAAGG + Intergenic
1146697671 17:34922391-34922413 TTGTACAGGCTTTGTTATTATGG - Intergenic
1148899049 17:50861546-50861568 TTGGAGTGGCTTGGTGAGGATGG - Intergenic
1150290344 17:63977769-63977791 TTGGACAGGCTTGGTGTGGAAGG - Intergenic
1154497997 18:14976470-14976492 TGGAAGAGGCTTTGTGAGCATGG + Intergenic
1158733328 18:60050669-60050691 TTGGAAAGGCTCTATGAGAAAGG - Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1164794251 19:31013712-31013734 TTTTAGAGGCTTTGTGTGTCAGG - Intergenic
1165135936 19:33668652-33668674 TTGGAGAGGCTTTTTTTGTGGGG + Intronic
1167752352 19:51388627-51388649 TAGGAGTGGCTTTGGGATTAGGG + Exonic
925873705 2:8293695-8293717 TTGGAGAGGATTAGAGAGTGAGG + Intergenic
925986391 2:9218558-9218580 TTGGAGAGGTTTTGAAAGGAAGG + Intronic
926488029 2:13487226-13487248 TTGGAGAGGATTAGTTACTAGGG + Intergenic
927292666 2:21420075-21420097 CAGGAGAGGCTGTGTGTGTAGGG - Intergenic
927834989 2:26388579-26388601 TTGGAGAGGCCTTATTAGTTAGG - Intronic
929393249 2:41495341-41495363 TTGGAGTGGCTTAGTGTGGAGGG - Intergenic
929414057 2:41729657-41729679 TTGGAGAGGCCCTGGGAATAAGG - Intergenic
929610407 2:43266757-43266779 CTGGAAAGGCTTTGTGGGAAAGG + Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
934045682 2:88170879-88170901 GTGGAGGGGTTTTGTGAGAAGGG - Intronic
936524341 2:113232716-113232738 GTGTAGGGGCTTTGGGAGTAGGG + Intronic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
936754086 2:115683570-115683592 GTGGAGAGGCTGTGTGTGTGTGG + Intronic
938279225 2:130052605-130052627 TCCGTGAGGCTTTGTCAGTAAGG - Intergenic
938436146 2:131284743-131284765 TCCGTGAGGCTTTGTCAGTAAGG + Intronic
938603483 2:132867477-132867499 TTGGTGTGGCTGTGTGAGTAAGG + Intronic
940004933 2:149001713-149001735 ATGGAGAGGCTATGTTAGAATGG - Intronic
940056125 2:149514291-149514313 TGGGAGAGGCTTTGTGTTGATGG - Intergenic
941867896 2:170353633-170353655 GTGGAGAGGCTGTGCGTGTAGGG + Intronic
943089079 2:183352652-183352674 TTGGAGAGGCTATGTATGTGTGG + Intergenic
945230699 2:207586396-207586418 TTGGAGTGGATTTTTGGGTATGG - Intronic
946074536 2:217063040-217063062 TGGCAGAAGCTTTATGAGTAGGG + Intergenic
947061135 2:226167427-226167449 TTGGTGAGGCTTTATGTGCATGG + Intergenic
1170413118 20:16111686-16111708 ATGGAGAGGCTTTGTGCACAGGG + Intergenic
1173435881 20:43031908-43031930 ATGGAGAGGCTTTGTGGTTGGGG - Intronic
1175733651 20:61370985-61371007 TTGGAGAGGCTTCCTGGGAACGG + Intronic
1177890260 21:26796076-26796098 GTGGAGAGGCTTTATGAAAAAGG + Intergenic
1180082546 21:45493440-45493462 TGGGTGAGGCTTTGTGGGGAAGG + Intronic
1180097000 21:45560395-45560417 TTGGAGACGCTATGTGGGAATGG + Intergenic
1180962871 22:19770212-19770234 TTGGAGAGTTTTTGGGAGTGAGG - Intronic
1182208195 22:28649965-28649987 TTTGATAGGCTTTGTGAGAGGGG + Intronic
949656067 3:6221439-6221461 TAGGAGGGGCTTTGTGATTTAGG - Intergenic
949891981 3:8740057-8740079 ATGGAGAGGCCATGTGAATAAGG - Intronic
951051461 3:18098758-18098780 TTGGAGAGGCTTTATGGTGAAGG - Intronic
956095305 3:65709963-65709985 TTGGAGAAGCTTTGATTGTAAGG - Intronic
959960177 3:112289135-112289157 TTGGTGAGGTTTTGTGAGAAAGG + Intronic
960898672 3:122532386-122532408 TGGGAGAGGCATTGTGGGGAGGG - Intronic
961513468 3:127418780-127418802 TTTGGGAGGCTTTGTGGGAAGGG - Intergenic
962023002 3:131519356-131519378 TTGGAGAGGTGGTGTGAGCAAGG - Intergenic
963688594 3:148470276-148470298 TTGAAGAGGCTTTGCCAGGATGG - Intergenic
964252857 3:154739913-154739935 TTGAAGAGGCATTGTGAGAGTGG + Intergenic
965460522 3:168956279-168956301 TTGGGGAGGCTTTGCGAGACAGG - Intergenic
967751196 3:193118261-193118283 CTGGAGAGGCTATGTGTGGAAGG + Intergenic
967998923 3:195187946-195187968 TTGTAGAGACTTTGTGAGAGAGG - Intronic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
971785152 4:31092524-31092546 TATGAGATGCTTTGTGAATATGG + Intronic
976378256 4:84369695-84369717 TTGGAAAGGCTTAGTTAGCACGG - Intergenic
977183935 4:93913820-93913842 TTGGAGCTGCTCTGTGATTAGGG - Intergenic
977983698 4:103357361-103357383 CTGGAAAGGTTTTGTGTGTATGG + Intergenic
977995763 4:103496392-103496414 GTGGTGAGGTTTTGTGGGTAAGG + Intergenic
979108685 4:116721285-116721307 TTGGAGAGGCCGTGTGTGTGCGG + Intergenic
983420580 4:167510287-167510309 TTGGAGTGGCTGTGTGATGAAGG - Intergenic
983595352 4:169460099-169460121 TGGGGGAGGCTGTGTGTGTATGG + Intronic
985162615 4:187060377-187060399 TTGGAGAGGGTGTGTGTGTGAGG + Intergenic
985766618 5:1783274-1783296 TTGAAGTGGCTTTGTGAGTCTGG + Intergenic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
988066661 5:26233683-26233705 TTCAAGAGGGTTTGTGACTATGG - Intergenic
989870935 5:46596567-46596589 TTGGAGAGACTTTTTGCCTATGG + Intergenic
989881965 5:46802560-46802582 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989882309 5:46809374-46809396 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989883020 5:46823350-46823372 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989884944 5:46861366-46861388 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989886499 5:46891706-46891728 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989889572 5:46952044-46952066 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989891453 5:46989203-46989225 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
989892304 5:47005738-47005760 TTGGAGAGCTTTTGTGCCTATGG + Intergenic
992616564 5:78551316-78551338 TTGGGGAGCCTTTTTGAGAATGG + Intronic
994130186 5:96218564-96218586 TGGGAAAGGCTTTGTGGGTGAGG - Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
995452314 5:112315166-112315188 TTGGACAGGCTTTATGAAGAAGG - Intronic
995851524 5:116551206-116551228 ATGCAGGGGCTTTGAGAGTAGGG + Intronic
996336363 5:122388071-122388093 TTGGAGAGGCTCTGGGAAAATGG + Intronic
997230407 5:132238486-132238508 GTGGAGGGGCTTTTTGAGCAAGG - Intronic
998567590 5:143229889-143229911 TAGGCGAGGCTTTCTGAGTATGG + Intergenic
999150294 5:149422138-149422160 TTTGAGAGGATTTGTGAGGTTGG + Intergenic
1000113108 5:158127880-158127902 TTGAAGAGGCCCTGTAAGTAAGG + Intergenic
1002051437 5:176573871-176573893 GTGGAGAGGCTGTGTGGGGAGGG + Intronic
1002289949 5:178193612-178193634 GTGGTTAGGCTTTGTGGGTAGGG + Intergenic
1006687171 6:35845332-35845354 TTGGGGAGGCTCTGTGTGTGGGG + Intronic
1006881573 6:37344493-37344515 GTGGAGAGGCTTGGGGAGTGGGG - Intergenic
1007673228 6:43574295-43574317 TTGGAGTTTCTTTTTGAGTAGGG - Intronic
1007903745 6:45437971-45437993 TTGGGGAGGATTTGTGAAGACGG - Exonic
1009249958 6:61286611-61286633 TTGGAAACGCTTTGTTTGTAGGG - Intergenic
1013336614 6:109169286-109169308 TTTGTGAAACTTTGTGAGTACGG + Intergenic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1016802776 6:148183365-148183387 TTGGGGAGGTTTTGTAAGTCAGG + Intergenic
1018559296 6:165084975-165084997 TTCGAGAGGCTTTGAGATAAGGG - Intergenic
1021530015 7:21633722-21633744 ACAGAGAGGCTTTGTGATTAAGG + Intronic
1022173001 7:27847440-27847462 TTGGAGTTGATTTGTGTGTATGG + Intronic
1023480466 7:40628376-40628398 GTGTAGATGTTTTGTGAGTATGG - Intronic
1025247672 7:57329231-57329253 TTGGAGAGGGTTTCTCAGCAGGG - Intergenic
1026518429 7:71093560-71093582 TTGGAAAGGCTTTCTGAGTAGGG + Intergenic
1028678895 7:93502117-93502139 TTGAAGAGGGGTTGGGAGTAGGG + Intronic
1034564354 7:151901391-151901413 TTGGAGAGGGTTTTTGAGCAGGG - Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1037095743 8:14984189-14984211 TTTGAGAGGATTGGAGAGTATGG - Intronic
1037383307 8:18311377-18311399 TTGCAGAGGCTTTGCAGGTAGGG - Intergenic
1044562556 8:93627296-93627318 TTGGAGCTTTTTTGTGAGTAAGG - Intergenic
1045015949 8:98002071-98002093 GTGGAGAGGCTTTATGAGACTGG - Intronic
1045854875 8:106753224-106753246 TTGGAAAGGATTTATGAGTTAGG + Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047401724 8:124553828-124553850 TTGGTGAGGCTTTCTGAAGATGG - Intronic
1050292704 9:4172831-4172853 TTGGAGAGCATTTGTGAGTATGG - Intronic
1050867940 9:10528029-10528051 TTGTTGAGGTTTTGTGAGAAAGG - Intronic
1057214564 9:93220733-93220755 CGGGAGAGGCTTTGTGGGTGTGG + Intronic
1057567806 9:96180533-96180555 TTGGAGAGGCTTCTGGAGCATGG + Intergenic
1057675444 9:97133243-97133265 TCGGTGAGGCCTTGTCAGTAAGG - Intergenic
1058267134 9:102915642-102915664 TTGGAGAGGCTTTGTGATTATGG - Intergenic
1062022153 9:134324929-134324951 TTGGACAGGGTGTGTGAATAGGG + Intronic
1203381265 Un_KI270435v1:47198-47220 TTGGAGAGCCTTGGGGATTATGG + Intergenic
1185631489 X:1518828-1518850 TTAGACAGGCTTTGGGAGTTAGG - Intronic
1187927341 X:24262240-24262262 TTGGAGAGCTTTTGTGACTAGGG - Intergenic
1188611621 X:32106527-32106549 AAGGAGAGGCTGTCTGAGTAGGG + Intronic
1190409908 X:50126155-50126177 TTGGAGAGGCTCTGTCACTCAGG + Intergenic
1190937780 X:55012288-55012310 TTGGAGAGGCTTTGTGAGTAAGG - Intronic
1190968890 X:55329889-55329911 TTGGAGAGGCTAGGCAAGTATGG + Intergenic
1194496932 X:94627713-94627735 TTGGAGAGGTTTTCTGGGTTGGG + Intergenic
1194974674 X:100381902-100381924 TTGTAGTGGCTGTGTGTGTAGGG - Intronic
1195939773 X:110158385-110158407 ATGTTGAGGCTTTGTAAGTAGGG + Intronic
1195986743 X:110638680-110638702 TTGGACTAGCTTTGTGACTATGG - Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1199266881 X:145838494-145838516 TTGAGGAGGCTTTGTAAGAAAGG + Intergenic
1200041086 X:153370051-153370073 TGAGAGAGGCTTTGTGAATATGG - Intergenic
1200228436 X:154432149-154432171 TTGGTGAGCCTTTATGGGTATGG + Intronic
1200296846 X:154928604-154928626 GTGGAGAGGCTCTGGGATTATGG - Exonic