ID: 1190939558

View in Genome Browser
Species Human (GRCh38)
Location X:55027394-55027416
Sequence GACAGAGAGGTGACTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190939558 Original CRISPR GACAGAGAGGTGACTAAAGC AGG Intronic
901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG + Intronic
902449057 1:16485160-16485182 CACAGAGGGGTGACCAAACCAGG + Intergenic
902468447 1:16631867-16631889 CACAGAGGGGTGACTAAACCAGG + Intergenic
902505693 1:16938124-16938146 CACAGAGGGGTGACCAAACCAGG - Intronic
903154678 1:21435791-21435813 GACAGGGGGGTGACCAAACCAGG - Intergenic
905091373 1:35433786-35433808 GACAGAGAGGGGACCACAGCGGG + Exonic
906782393 1:48584347-48584369 GACAGAGAGGGGAGTACAGAAGG - Intronic
907805987 1:57820787-57820809 GACAGAAAGGGGACTAAACCAGG - Intronic
907926300 1:58958091-58958113 GACATGGAGGTGAGGAAAGCAGG + Intergenic
910497525 1:87848956-87848978 GACAGAGAGGTATTTAAGGCAGG - Intergenic
911820283 1:102410814-102410836 CACAGTGAGGTGAATAAATCAGG + Intergenic
912334054 1:108846265-108846287 GACCGAGAGGAGAGTAAAGGTGG - Intronic
912694208 1:111828704-111828726 GACAGAGAGCTGAGCAGAGCTGG - Intronic
913970095 1:143408390-143408412 GATAGAGAGGTGGCTGAGGCAGG - Intergenic
914064469 1:144233987-144234009 GATAGAGAGGTGGCTGAGGCAGG - Intergenic
914114681 1:144732367-144732389 GATAGAGAGGTGGCTGAGGCAGG + Intergenic
914452664 1:147806543-147806565 GACAGAGAGGAAAATCAAGCTGG + Intergenic
914890522 1:151618280-151618302 GAGAGACAGGGGACTAAAGCAGG + Intronic
918288300 1:183080497-183080519 GAAAGGGAGGTGACAAAAGTGGG - Intronic
918799378 1:188953252-188953274 GACAGAGAGGGGGCTGCAGCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923158609 1:231299169-231299191 GCCAGGCAGGTGACTAAGGCAGG - Intergenic
924836308 1:247651206-247651228 GAGAGACAGAAGACTAAAGCAGG - Intergenic
1063497135 10:6520410-6520432 GACTGAGAGGTGACCAAGGCTGG - Intronic
1064057795 10:12112333-12112355 GAAAGAGAGTTGACAAAATCTGG - Intronic
1066473671 10:35724100-35724122 GACAGAGAGGGGAGCAGAGCTGG - Intergenic
1067993557 10:51243213-51243235 CACAGACAGCTGACTTAAGCAGG + Intronic
1069156295 10:65034836-65034858 AACAGAGAGGAGACTCAAGTGGG - Intergenic
1070504239 10:77099091-77099113 GACTGAGAGAAGACTAAGGCAGG + Intronic
1070842220 10:79495080-79495102 GACCTAGAGGTGGCTAAGGCCGG - Intergenic
1071312318 10:84354326-84354348 GACAGAAACCTGACTACAGCAGG - Intronic
1071496106 10:86168656-86168678 GGCAGAGCGGTGAGTAAGGCTGG + Intronic
1075463451 10:122633676-122633698 AACAGTGAGGTGAGGAAAGCAGG - Intronic
1076697140 10:132252292-132252314 GCCAGGGAGGGGGCTAAAGCAGG + Intronic
1076903418 10:133350851-133350873 GACAGACAGGAGAGCAAAGCAGG - Intronic
1077894713 11:6445288-6445310 GATATAGCAGTGACTAAAGCAGG - Intergenic
1082898769 11:58222364-58222386 GATGGAGAGGTGACTAAATAAGG - Intergenic
1083913346 11:65723490-65723512 GAAAGAGAGGTGACTAATTCTGG - Intergenic
1085905417 11:80755223-80755245 GACAAAGTGGCGACTAAAACAGG - Intergenic
1087283349 11:96237233-96237255 CACAGAGATGGGACTTAAGCAGG - Intronic
1088708761 11:112487341-112487363 GGCAGAGTGGTGAATAAAACAGG + Intergenic
1092110058 12:5953735-5953757 GACTGAGAACTGACAAAAGCTGG - Intronic
1093053926 12:14535672-14535694 GAAAGAGAGGCGACTACTGCTGG + Exonic
1093361950 12:18239709-18239731 AACAGAAAGGGGACAAAAGCTGG - Intronic
1093507531 12:19885859-19885881 GACAGAGTTGGGACTGAAGCTGG + Intergenic
1094539622 12:31352317-31352339 GACTGAGAGGTAACCCAAGCTGG - Intergenic
1094686812 12:32725445-32725467 CACAGTGAGGTGAATAAAACAGG - Intronic
1095916099 12:47480646-47480668 CACAAAGAGGTGACAATAGCAGG - Intergenic
1096155419 12:49339007-49339029 GAGAGAGAGGTTCCTAAGGCTGG + Intergenic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1096254004 12:50051886-50051908 GACAGAGAGGTGGAGAAATCGGG - Intergenic
1098894918 12:76047797-76047819 CACAGTGAGGTGAATAAAACGGG - Exonic
1102262931 12:111456000-111456022 CACAGAAAGTTGGCTAAAGCTGG + Intronic
1102458904 12:113087925-113087947 CAGAGAGAGGTGGCCAAAGCAGG + Intronic
1102929798 12:116853504-116853526 GAAAGAGAGGTAAATAAAGTGGG + Intronic
1105777284 13:23675300-23675322 GACAGAGAGATGATGAAAGTAGG + Intronic
1107238677 13:38204808-38204830 GGCTGATAAGTGACTAAAGCTGG - Intergenic
1107414186 13:40186213-40186235 GACAGGGAGGTGGCTACAGATGG - Intergenic
1107731687 13:43355582-43355604 GACAGAAAGGTCCCCAAAGCAGG - Intronic
1108628438 13:52255585-52255607 TACAGAGAAGTGCCTAAAGGAGG + Intergenic
1108690497 13:52855398-52855420 TACAGAGAGGTGATGAAAGCCGG + Intergenic
1110239762 13:73254171-73254193 TTCAGAGAGGTGAGCAAAGCAGG + Intergenic
1111028782 13:82569292-82569314 GACAGAAAGGTGCCTCAAGAGGG + Intergenic
1112265679 13:97921198-97921220 GACAGAGAAGTCACTGAACCGGG - Intergenic
1112347388 13:98601671-98601693 GTCAGAGAGTTGACTGAGGCTGG - Intergenic
1112626650 13:101112072-101112094 TAAAGAGAAGTAACTAAAGCTGG + Intronic
1113992144 14:16035983-16036005 GACAGAGAGGTGAGTAGACAGGG + Intergenic
1114363581 14:22002961-22002983 GACAGAGAGGAGCCTCAAGAGGG + Intergenic
1114599605 14:23943580-23943602 GACAGAGAGTTGACAGAAGTAGG + Intergenic
1115386116 14:32799114-32799136 GACAGAGAAGTGAATAGAGGAGG + Intronic
1115487478 14:33925933-33925955 GACAGAAAGGAGAATAAAGAGGG + Intronic
1117633210 14:57715067-57715089 GAAAGAGAGGCGAGTAAAGATGG + Intronic
1118367374 14:65107621-65107643 GACAGAGTGGTGACCAGAACTGG + Intergenic
1118843609 14:69529683-69529705 GGCAGCAAGGTGACTGAAGCAGG - Exonic
1119967017 14:78928112-78928134 GACAGAGAAGGGAGGAAAGCTGG - Intronic
1121578848 14:95011185-95011207 GACAGAGAAGCCACTAAAACGGG + Intergenic
1122008110 14:98722461-98722483 GACAGAGAATTGTCTAAATCTGG - Intergenic
1124466107 15:29941337-29941359 AACAGAGAGAGGACTAAGGCAGG - Intronic
1125009276 15:34852880-34852902 GAGAGATAAGTGAATAAAGCTGG + Exonic
1126080417 15:44955962-44955984 GTCAGAGAGGTGACTAAAGTAGG + Intergenic
1127283157 15:57509344-57509366 GACAGAAAGGAAACAAAAGCCGG + Intronic
1128375537 15:67072387-67072409 GAAGGAGAGGTGAATAAAGGTGG - Intronic
1128806823 15:70537177-70537199 GACATACAGGTTACAAAAGCAGG + Intergenic
1129118205 15:73378165-73378187 GACAGAAATGTGACTAAATCTGG + Intergenic
1129764450 15:78152877-78152899 GATAGAGATGTGACTGAGGCTGG + Intronic
1134670908 16:16054366-16054388 CACAGAGAGGTCCCCAAAGCAGG - Intronic
1134757640 16:16682552-16682574 CACAGAGAACTGACTAATGCAGG + Intergenic
1134988429 16:18676614-18676636 CACAGAGAACTGACTAATGCAGG - Intergenic
1135432814 16:22401028-22401050 GACACAGAGGTGTCTGAACCAGG - Intronic
1136911519 16:34147954-34147976 GACAGAGAGGTGACTAGACAGGG + Intergenic
1138237326 16:55395691-55395713 GGCAAAGAGGTGTCTAAATCAGG - Intronic
1140865077 16:79052995-79053017 GTCAGAGAGGTGGCAAAAGCAGG + Intronic
1141557853 16:84847680-84847702 GAAAGTGAAGTGTCTAAAGCAGG + Intronic
1143580301 17:7821714-7821736 GACAGAGAGAGGAGAAAAGCTGG - Intronic
1143829665 17:9641119-9641141 GAGAGACAGGTGCCTAAAGGAGG - Intronic
1144209456 17:13002389-13002411 GAAAGAGAGGGGACGAGAGCTGG + Intronic
1144494022 17:15735898-15735920 GACAGAGAGGGGACTAGAGCAGG + Intronic
1144906239 17:18640781-18640803 GACAGAGAGGGGACCAGAGCAGG - Intronic
1146605510 17:34254401-34254423 GACAGAGAGAGGACCCAAGCAGG + Intergenic
1147848027 17:43419038-43419060 GGCAGAGTGGTGACTAAGGCTGG - Intergenic
1148856337 17:50581045-50581067 GACAGAGAGGAGACTGATGGGGG + Intronic
1156811250 18:41255098-41255120 GACAGAGAGGTTGCAAAGGCAGG + Intergenic
1158535942 18:58308583-58308605 CACAGAGAGGAGAATAAAGGCGG + Intronic
1159083600 18:63761912-63761934 GACAGAGAGGTGGCCCCAGCAGG - Intronic
1160346609 18:78137534-78137556 CACAGACAGGAGAGTAAAGCTGG + Intergenic
1161411346 19:4119815-4119837 GCCAGAGAGGGGACTGAAGCAGG + Intronic
1161943830 19:7422115-7422137 GACAGAGAGATGACAGAGGCAGG - Intronic
1166813650 19:45528659-45528681 GAATGAGAGGTGGCTAAATCCGG + Exonic
1168136362 19:54354966-54354988 AACAGTCAGGTGAATAAAGCTGG + Exonic
926401818 2:12504812-12504834 CACAGAGAGCTGACTACATCTGG + Intergenic
926740532 2:16106838-16106860 GACACGGAGGTGAGAAAAGCAGG - Intergenic
927398844 2:22687341-22687363 GAGAGAGAGGTCACTAGAACTGG + Intergenic
928943199 2:36748791-36748813 GACACAGAGGTGAAAAAAGGAGG - Intronic
929624543 2:43393136-43393158 GACAGAGAGATGAGTAGAGAGGG + Intronic
930008823 2:46918983-46919005 GACAGAGAGGTGGCTTTATCAGG + Intronic
930055052 2:47245513-47245535 GTTAGAGAGGTGACTAGAGATGG + Intergenic
930259063 2:49124085-49124107 GACAGAGAATTGCCTAAACCCGG - Intronic
931959808 2:67469916-67469938 GAAAGGGAGGTGCATAAAGCTGG - Intergenic
934174785 2:89569299-89569321 GATAGAGAGGTGGCTGAGGCAGG - Intergenic
934285102 2:91643651-91643673 GATAGAGAGGTGGCTGAGGCAGG - Intergenic
935137457 2:100320919-100320941 GACAGAGAGCAGGCTAGAGCCGG + Intronic
937383943 2:121408413-121408435 GTCAGAGAAGTGAATAAAGTGGG - Intronic
937800426 2:126075536-126075558 GAATGAGAGGTGAGTAAAGAAGG + Intergenic
938539595 2:132275276-132275298 GACAGACAGGTGACTAGACAAGG - Intergenic
939125880 2:138176959-138176981 GGCAGAGGGGTTACTAAATCAGG - Intergenic
940159276 2:150693845-150693867 GACAGAGAGTAGAGGAAAGCAGG + Intergenic
940972433 2:159908149-159908171 GACACAGAAGTGAATGAAGCAGG - Intergenic
941873143 2:170406629-170406651 GACAGAGAGGTGAGAAGAGGAGG - Intronic
943086346 2:183316496-183316518 GAGAGAGAGGTGACTGAGTCAGG + Intergenic
944204412 2:197142655-197142677 GAAAGAGGGGTGATTAAACCAGG - Intronic
944204881 2:197147657-197147679 GACAGAGGGATGACTACAACAGG + Intronic
944284036 2:197927649-197927671 GCCAGAGAGGTTTCTAAATCTGG - Intronic
946660772 2:221997242-221997264 TCCAGAGAGGTGAGTAATGCTGG - Intergenic
947319124 2:228897024-228897046 GAGAGAGTGGTGAGCAAAGCAGG - Intronic
1168901518 20:1368968-1368990 GACACAGAGCTGAGAAAAGCCGG + Exonic
1171769711 20:29313285-29313307 GACAGAGAGGTGACTAGACAGGG - Intergenic
1171812434 20:29756436-29756458 GACAGAGAGGTGACTAGACAGGG - Intergenic
1171868520 20:30508185-30508207 GACAGACAGGTGACTAGACAGGG - Intergenic
1171906845 20:30906231-30906253 GACAGAGAGGTGACTAGACAGGG + Intergenic
1172301403 20:33852995-33853017 GAGAGGGAGGTGACCACAGCTGG - Intronic
1174980493 20:55388903-55388925 GATACAGTGGTGACTAAAACAGG - Intergenic
1175295698 20:57907445-57907467 AACTGAGAGGTGAGAAAAGCTGG + Intergenic
1180315127 22:11271544-11271566 GACAGAGAGGTGAGTAGACAGGG - Intergenic
1180576019 22:16775251-16775273 GACAGAGAAGTGAAGAAACCAGG - Intergenic
1180835421 22:18927183-18927205 GACAGAGATGTGACAGAAGAGGG + Intronic
1181322769 22:22021337-22021359 GACAGAGAAGTGAGTAAGGCTGG + Intergenic
1181838152 22:25628046-25628068 GACAGACAGGTCATTAAAACGGG + Intronic
1203285509 22_KI270734v1_random:152482-152504 GACAGAGATGTGACAGAAGAGGG + Intergenic
952695448 3:36260297-36260319 GACAGTGAGGTGGGGAAAGCAGG + Intergenic
953879663 3:46685117-46685139 GACTGAGGGGTGACTAAGGAGGG - Intronic
954332276 3:49897424-49897446 GACATAGAGGTGGCTTAGGCAGG + Intronic
955917578 3:63922405-63922427 GTCAAAGAGGTGGCTAAAGGAGG - Intronic
960454940 3:117859580-117859602 AACAGAGAGGTGACTGAAGGAGG - Intergenic
960738563 3:120807345-120807367 CACAGTGAGGTGAATAAAACAGG + Intergenic
963597739 3:147349157-147349179 GAGAGAGAGATGAAGAAAGCTGG + Intergenic
966956444 3:184885132-184885154 GAGAGAGAGGTGACTAAAGAAGG - Intronic
967616112 3:191568653-191568675 GGCTGAGAGGTGACTAAGTCAGG + Intergenic
969828636 4:9778219-9778241 GAGAGAGAGGTGGCTGAGGCAGG - Intronic
969835305 4:9835430-9835452 GGCAGAGTGGTGACTCCAGCTGG - Intronic
970290599 4:14567053-14567075 CACAGAAAGGTGAATAAAGTTGG - Intergenic
971101958 4:23476734-23476756 GACACACAGGTGACTAAACCAGG - Intergenic
971542772 4:27841847-27841869 GTGAGAGAGGTGAATAAAGAAGG - Intergenic
971757362 4:30721024-30721046 GACAGAGCGGGGACTAGAGCCGG + Exonic
974147724 4:57967413-57967435 CACAGGGAGGTGGCTAAGGCTGG - Intergenic
974293149 4:59960528-59960550 GTCAGGGAGCTGACAAAAGCAGG - Intergenic
974363049 4:60907855-60907877 GACACAGTGGTGACTAAAGTTGG + Intergenic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
979366634 4:119832716-119832738 GACAGACAGGTGACTACTGTAGG + Intergenic
983966948 4:173824095-173824117 GACAGAGAGCTGACACAAGATGG + Intergenic
984169111 4:176340095-176340117 GACAGAGCAGTGACCAAAGCAGG + Intergenic
984270351 4:177541703-177541725 GACAGAGAGGTGACGCCAACTGG - Intergenic
984755166 4:183319469-183319491 CACAGTGAGATGACTAGAGCGGG + Exonic
985383193 4:189417221-189417243 GACAGAGTGATGACCAAAGAAGG - Intergenic
985572291 5:654556-654578 GACAGAGAGGTGACACAAGAGGG - Intronic
985677033 5:1237521-1237543 GCCGGAGAGGGGACCAAAGCAGG + Intronic
986364310 5:7015774-7015796 GCCAGGGAGGTGGGTAAAGCAGG + Intergenic
987781712 5:22445659-22445681 GATAGAAAGAGGACTAAAGCTGG + Intronic
988094066 5:26580188-26580210 GACACAGAGGTCTCTAAAACAGG - Intergenic
988478829 5:31612288-31612310 TACAGTGAGGTGAATACAGCAGG - Intergenic
990370243 5:55110396-55110418 GACAGAGAGATGAATAATTCAGG - Intergenic
994665237 5:102697029-102697051 GGCAGAGATGTGACCAGAGCAGG - Intergenic
994821427 5:104655727-104655749 GAATGAGAGCTGAGTAAAGCAGG - Intergenic
998917073 5:147025789-147025811 GACACAGAGGAAACTAAAACTGG + Intronic
1002801084 6:522127-522149 TACAGAGAGGAGACACAAGCAGG + Intronic
1003477268 6:6494997-6495019 GCCAGAGGTGTGACTACAGCCGG - Intergenic
1003543632 6:7039898-7039920 AACAGAGAGGTCACTAAGACAGG + Intergenic
1004249456 6:14011507-14011529 GACAGGGAGGTGGCTAATGGTGG + Intergenic
1004886845 6:20059276-20059298 AAGAGAGAGGTGAGCAAAGCAGG - Intergenic
1005520597 6:26597491-26597513 GAAAGAGAGGTGAACAGAGCCGG - Intronic
1005677867 6:28174289-28174311 GACAGAGAGGAGACAAAAGCTGG - Intergenic
1006358633 6:33575255-33575277 GACAGAGGAGTGACTGGAGCTGG + Intronic
1007241324 6:40427766-40427788 GACAGAGAGATGCCTAAGACAGG - Intronic
1007410071 6:41656485-41656507 GACAGGGAGGTGAGGAAGGCAGG - Intergenic
1012033673 6:94104339-94104361 GACAGATAGGTGAATACAGAAGG + Intergenic
1013208749 6:107968211-107968233 GACAGGAAGATGACAAAAGCAGG + Intergenic
1014440230 6:121465372-121465394 GGCAGGGAGGTGAGTACAGCAGG + Intergenic
1014985905 6:128009196-128009218 GACAGAGTGGTGAAAATAGCAGG - Exonic
1016569647 6:145497796-145497818 GACAGAGTGGTTCCTTAAGCAGG - Intergenic
1016626934 6:146181788-146181810 GAAAGAGAGGTGAATAAATATGG + Intronic
1017081661 6:150675227-150675249 AACAGAGAGGGGACTGAAGGGGG - Intronic
1019691085 7:2412997-2413019 GACAGAGAGATAAGTAAGGCCGG + Intronic
1020474587 7:8580819-8580841 GACAGAGATTTGAAGAAAGCAGG - Intronic
1022132618 7:27418158-27418180 GAGAGAGAGGTGAACAAATCTGG + Intergenic
1023457296 7:40354325-40354347 GACGGAGAGGTGGGAAAAGCAGG + Intronic
1023563696 7:41502157-41502179 GATAAAGAGGTGACTAAAGAGGG - Intergenic
1023995435 7:45156636-45156658 GGCAGAGAGGTGCCTCTAGCTGG + Intergenic
1024320886 7:48067990-48068012 GAAATAGAAGTGACAAAAGCAGG - Intergenic
1024637144 7:51300461-51300483 GAAACAGAGGTTATTAAAGCGGG + Intronic
1026467191 7:70664416-70664438 GACAGAGAGGGAACTAAAAGAGG - Intronic
1028859660 7:95634596-95634618 GACAGAGAGGGGAAGAAAGATGG + Intergenic
1030301192 7:107976483-107976505 GAGAGCGAGATGATTAAAGCTGG - Intronic
1030747464 7:113184470-113184492 GACAGAGAGGTCACTAACTGGGG + Intergenic
1035370219 7:158375164-158375186 GTCAGAAAGGTGCCTAAACCTGG + Intronic
1035495479 7:159321777-159321799 GAAATAGAGATGACTAAAACTGG + Intergenic
1039830772 8:41212113-41212135 CAAAGAGAGGTGACAAAAGTAGG - Intergenic
1039967632 8:42294760-42294782 GACAGAGAAGAGACTCATGCGGG - Intronic
1042406094 8:68406936-68406958 CACAGAGAGGAGAGTAAACCAGG + Intronic
1043383816 8:79729742-79729764 CACAGGGAGGTGAGTGAAGCTGG - Intergenic
1043428091 8:80168817-80168839 GACACAGAGGTTACTATGGCTGG + Intronic
1046084498 8:109415556-109415578 GGCAGAAAGGTGACAAAAGATGG + Intronic
1048142967 8:131812974-131812996 CACAGAGAGGTTAAGAAAGCTGG + Intergenic
1048252996 8:132882850-132882872 AACATAGGGGTGACCAAAGCTGG - Exonic
1048291585 8:133185415-133185437 GACACAGAAGTGACCCAAGCCGG + Intergenic
1050019966 9:1272662-1272684 GACACAGAGATGAGTAAAGTGGG + Intergenic
1050510058 9:6384775-6384797 GACTGAGGGGTGAGTAAAGCAGG + Intergenic
1050530127 9:6581347-6581369 GACAGGGAAGTGAGGAAAGCTGG - Intronic
1050711923 9:8475041-8475063 GAAAGAGAGGTGACTAGAGTGGG - Intronic
1051396448 9:16626982-16627004 GACAGTGAGGCGACTGAATCAGG + Intronic
1052477719 9:28981799-28981821 GATGGAGAGGTGAATAAATCAGG + Intergenic
1058314002 9:103541631-103541653 TACAGTGAGGTTACTAAATCAGG - Intergenic
1058607449 9:106737994-106738016 TTCAGAGAGGTGAAAAAAGCAGG + Intergenic
1060581031 9:124746846-124746868 GAAAAATAGGTGAGTAAAGCTGG + Intronic
1060586905 9:124792358-124792380 GACACACAGGTGCCTAAATCAGG - Intronic
1203363412 Un_KI270442v1:237453-237475 GACAGAGAGGTGACTAGACAGGG - Intergenic
1186751711 X:12628450-12628472 GACAGAGAAGTGGCTAAGGGAGG - Intronic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1186876662 X:13824582-13824604 GACAGATAGGAGACTGAAGAGGG + Intronic
1188021356 X:25162159-25162181 GAAAGAGAGGTGACAGAATCAGG - Intergenic
1190539941 X:51466901-51466923 GATACAGAGATGACTCAAGCTGG + Intergenic
1190939558 X:55027394-55027416 GACAGAGAGGTGACTAAAGCAGG + Intronic
1195254784 X:103080961-103080983 GACAGGGAGGTGAGTGACGCAGG + Intronic
1197594864 X:128452327-128452349 GAAAGAGAGGTAAGCAAAGCAGG - Intergenic
1198277852 X:135113098-135113120 GACAGAGAGGGAGCTACAGCGGG - Intergenic
1199753421 X:150842872-150842894 GACAGTGAGCTGCCTTAAGCAGG + Intronic
1201074892 Y:10179385-10179407 AACAGAGAGGTGACTAGACAGGG + Intergenic
1201784559 Y:17759836-17759858 GACAGAGAAGTGAAGAAACCAGG - Intergenic
1201816994 Y:18146151-18146173 GACAGAGAAGTGAAGAAACCAGG + Intergenic