ID: 1190949416

View in Genome Browser
Species Human (GRCh38)
Location X:55128207-55128229
Sequence CAGTATCTGCAATTTATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190949416_1190949417 29 Left 1190949416 X:55128207-55128229 CCTTCAATAAATTGCAGATACTG 0: 1
1: 0
2: 3
3: 15
4: 229
Right 1190949417 X:55128259-55128281 CTGATTGACTGAGTTCAAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190949416 Original CRISPR CAGTATCTGCAATTTATTGA AGG (reversed) Intronic
902074858 1:13776261-13776283 CAGTATTTGCAAGTGATTGGGGG + Intronic
902660954 1:17903346-17903368 GTGTATTTGCAATTTATGGATGG + Intergenic
903250413 1:22049237-22049259 CAGTAGCAGCAATATCTTGATGG - Intergenic
904078658 1:27858369-27858391 CAGTGTCTGCATTTTACAGATGG + Intergenic
906176687 1:43780227-43780249 CAGTATCTTCAAAATACTGAGGG - Intronic
909765332 1:79348964-79348986 CATTCTATGCAATTTATTTAGGG + Intergenic
910032995 1:82753980-82754002 CAGTAACTGCAATATATTGATGG - Intergenic
911569148 1:99501768-99501790 TAGTATTTGCAATTTATACATGG + Intergenic
912327654 1:108784258-108784280 CAGTCTCAGCTATTTATTCATGG - Intronic
912951198 1:114121738-114121760 CAGTATTTCCATTTTATAGATGG - Intronic
913017025 1:114748150-114748172 CTTTATTTCCAATTTATTGAAGG - Intronic
913964698 1:143366167-143366189 TAGTATTTTCAATTTTTTGAAGG + Intergenic
915956570 1:160225119-160225141 CAGTATCTGCTCCTTATTGCAGG - Exonic
917011286 1:170475419-170475441 CAGTAACAACAATGTATTGAAGG + Intergenic
917459826 1:175220656-175220678 TAGTATCTGCAATGAATTTAGGG - Intergenic
917724969 1:177819604-177819626 CAGAATCTGCATTTTAATGAGGG - Intergenic
919318826 1:196007750-196007772 TAGTTTCAGCAATTTACTGAAGG + Intergenic
920361268 1:205418207-205418229 CAGGAACTACCATTTATTGAAGG - Intronic
921224363 1:213003132-213003154 AAGTCTCTTCAATTTTTTGAAGG - Intronic
921467532 1:215507366-215507388 GAGTATCTGCTAATTCTTGATGG + Intergenic
921486718 1:215723496-215723518 CAACATGGGCAATTTATTGATGG + Intronic
923952497 1:238974140-238974162 CAGGACCTCCAATATATTGATGG + Intergenic
1063429252 10:5975539-5975561 CAATATATGCAGTTTATTGTCGG + Intronic
1068657104 10:59587105-59587127 CAGCAGTTACAATTTATTGAAGG + Intergenic
1069491827 10:68867548-68867570 CATTATCTTCAAGGTATTGAGGG + Intronic
1069599712 10:69695752-69695774 CAGTTTCTTCAACTGATTGATGG + Intergenic
1071914004 10:90269909-90269931 CAGGTTCTGCTATTTATGGATGG + Intergenic
1072551860 10:96484672-96484694 CAGTAGATGCAATCTATTGAAGG + Intronic
1074435647 10:113432055-113432077 CAACATCTGCAAGATATTGATGG + Intergenic
1075203105 10:120422703-120422725 CAGTGTCTGCTACTTATGGATGG + Intergenic
1075241334 10:120781615-120781637 GAGAAACTGGAATTTATTGAAGG - Intergenic
1079279475 11:19074490-19074512 CAGGAGCTACCATTTATTGAAGG - Intergenic
1079624725 11:22602570-22602592 TAGTTTCTGCAATTTGTTAAAGG - Intergenic
1079722132 11:23828999-23829021 CAGTATCTGAGATTTTTTAATGG - Intergenic
1082250716 11:49977175-49977197 CAGTATGTACAATGGATTGATGG + Intergenic
1084977477 11:72810413-72810435 CAGCAACAGCAATTTATTTACGG + Intergenic
1086500313 11:87446195-87446217 TACTAGCTGCAACTTATTGATGG + Intergenic
1086897691 11:92332664-92332686 CATTATCTCCATTTTATGGATGG - Intergenic
1087927443 11:103935750-103935772 CAGTAGCTATCATTTATTGAGGG + Intronic
1090159596 11:124478708-124478730 CCTTTTCTGGAATTTATTGATGG + Intergenic
1090399415 11:126439513-126439535 CAGTATCTGCATTTTTTTAAAGG - Intronic
1091981636 12:4868861-4868883 GACTATCTGCAACTTATGGATGG + Intergenic
1095442578 12:42252962-42252984 CAGTTTCTTCATATTATTGATGG + Intronic
1096046413 12:48566549-48566571 CTGTTTCTGCTACTTATTGAGGG - Intergenic
1096525070 12:52205514-52205536 CAGTGGCTGCCATTTACTGAGGG + Intergenic
1097322247 12:58238985-58239007 CAATAATTGCAATTTATTGATGG - Intergenic
1097572571 12:61353200-61353222 CAGTAGATGCAATTTATTTTAGG + Intergenic
1097600976 12:61693308-61693330 TACTATCTGCATTTTACTGATGG - Intergenic
1098164387 12:67678751-67678773 AAGTATCTGTATTTTATAGATGG + Intergenic
1098676659 12:73297342-73297364 CAGTGTCTGGAATATTTTGAAGG + Intergenic
1098838535 12:75450577-75450599 CATTATATCCAGTTTATTGATGG + Intergenic
1099907309 12:88787288-88787310 CATTATGTCCAATTGATTGATGG - Intergenic
1100059848 12:90561177-90561199 AAGTATCTGCAATTAATCTATGG - Intergenic
1100117198 12:91321479-91321501 AAGTATTTTCAATGTATTGATGG + Intergenic
1100482494 12:94992742-94992764 TAGTATCTGGCATTTATTGCTGG - Intronic
1101335327 12:103791549-103791571 CAGGATGTGGAGTTTATTGAGGG - Intronic
1102393544 12:112569075-112569097 CAATATCTGCCACTTACTGAGGG + Intergenic
1104521451 12:129479398-129479420 CAGAATCTGGAATTTCTTGGTGG + Intronic
1105659967 13:22483415-22483437 CACTATGTGCACTGTATTGAAGG + Intergenic
1108546266 13:51498172-51498194 CAGTATCTGCCTCTTAGTGATGG - Intergenic
1108676804 13:52744110-52744132 CAGTATCAGGAAGTCATTGAGGG + Intergenic
1109157755 13:58932065-58932087 CATTTTCTGCAATTTTCTGAGGG + Intergenic
1109362106 13:61307069-61307091 CACAATCTGCAATATACTGAAGG + Intergenic
1112155660 13:96814333-96814355 CAGTAGCTTCAAATTTTTGAGGG - Intronic
1115102316 14:29717367-29717389 CAGTATCTCCAATATATGGTTGG - Intronic
1115370322 14:32606248-32606270 CAGTATGTTCAATTTTTTAATGG + Intronic
1115438876 14:33408895-33408917 GAGTATGTGGAATATATTGAGGG + Intronic
1117075428 14:52098496-52098518 CAGTAACAGCAGTTAATTGATGG - Intergenic
1118850443 14:69579023-69579045 CAGTATTTGCAAGTTCTTAAGGG + Intergenic
1120029295 14:79622528-79622550 CAGGATCTGGGATTTAGTGAGGG + Intronic
1120825628 14:88952316-88952338 CAGTGGCTGCCATATATTGAGGG - Intergenic
1125992096 15:44119580-44119602 AAGGATCTGAAATTTATTCATGG - Intronic
1126719555 15:51562946-51562968 GAGCACCTGCAAGTTATTGAAGG + Intronic
1128100787 15:64997983-64998005 CAATAGCTACCATTTATTGAGGG + Intergenic
1133933610 16:10251828-10251850 CAACAGCTGCCATTTATTGAGGG - Intergenic
1134510651 16:14844247-14844269 TAATAGCTGCAATTTACTGAGGG - Intronic
1134698289 16:16242733-16242755 TAATAGCTGCAATTTACTGAGGG - Intronic
1134973547 16:18551944-18551966 TAATAGCTGCAATTTACTGAGGG + Intronic
1135571764 16:23554919-23554941 CAGTAGCTGAAATTAATTGAGGG - Intronic
1135584283 16:23656481-23656503 CAGTTTCTGCAATATATAAATGG - Intronic
1144025579 17:11273597-11273619 CAGTAGCTGGGATTTGTTGAGGG + Intronic
1146102589 17:29998430-29998452 CAGTATCTGGAACTAAGTGAGGG - Intronic
1148158300 17:45435958-45435980 GAGTCTTTGCAATGTATTGAAGG - Exonic
1153557996 18:6337006-6337028 CAATATCTGAAACTCATTGATGG + Intronic
1153628892 18:7049755-7049777 CAATGTCTTCAGTTTATTGAAGG + Intronic
1154962274 18:21321351-21321373 CAGTATTTTCAATCTGTTGATGG - Intronic
1156172070 18:34497461-34497483 CATTATCTCCATTTTATAGAAGG + Intronic
1156178828 18:34579577-34579599 CAATATCTGCAAAGTATTGAAGG - Intronic
1156679941 18:39576290-39576312 GAGTTTCTGTAATTTATTCAAGG + Intergenic
1157922177 18:51724434-51724456 CAATATCTGTAAATTATTGCTGG + Intergenic
1158069801 18:53457358-53457380 CAGAATTTGTAATTTATTGCTGG + Intronic
1158185659 18:54768616-54768638 CAGTCTCAGCTATTTATTCATGG - Intronic
1158531385 18:58265447-58265469 CAGTTTCTGCCATTTAATGGTGG + Intronic
1164504049 19:28843500-28843522 AAGTGTCTGCCATTTATTGGTGG + Intergenic
1164730354 19:30499216-30499238 CAGTATCTGCTCTTTTTTGAGGG + Intronic
1166404698 19:42511627-42511649 CAGTTTCTGATATTTATTTAGGG - Exonic
1167200397 19:48061315-48061337 CAGTATCTGCCACTTACTGTGGG - Intronic
1167282015 19:48574933-48574955 AAGTAACTGCAGTTTATTGAAGG + Intronic
1202698474 1_KI270712v1_random:143657-143679 TAGTATTTTCAATTTTTTGAAGG + Intergenic
925540111 2:4957553-4957575 CAGTATCTCCATTTTACAGATGG - Intergenic
926332029 2:11833481-11833503 CATTAACTTCATTTTATTGAGGG + Intergenic
927702862 2:25278923-25278945 CAGAATCTGCATTTTAAAGAGGG - Intronic
928920198 2:36519169-36519191 CACTAGCTGAAATTCATTGATGG + Intronic
929210060 2:39345980-39346002 CAGGATCTGCAATTCATAGGTGG + Intronic
930047518 2:47186198-47186220 CAGGATCAGCATTTTATTCAAGG + Intergenic
931667878 2:64623244-64623266 CAGACTCTGCAATTCAGTGAGGG + Intergenic
932354671 2:71058953-71058975 CAGTATCTGCGGTATATTCAGGG + Intergenic
934279721 2:91601439-91601461 TAGTATTTTCAATTTTTTGAAGG + Intergenic
935734213 2:106093838-106093860 CAAAATCTGCAGTTTTTTGAGGG + Exonic
937461675 2:122094321-122094343 AACTCTCTTCAATTTATTGAAGG - Intergenic
938592872 2:132756351-132756373 AAGTTTCTGCAACTTTTTGAGGG - Intronic
939230531 2:139419807-139419829 CAGTATCTTGATTTTACTGAGGG + Intergenic
941787533 2:169514802-169514824 CAGAACCTGGAATTTACTGAAGG + Intronic
943196708 2:184761775-184761797 AAGTGTCTGCAATTGTTTGAAGG + Intronic
943954620 2:194172849-194172871 CACCAACTGCAATTTATTCATGG + Intergenic
947275582 2:228388049-228388071 CAGTACTGGTAATTTATTGATGG + Intergenic
1170501625 20:16980521-16980543 AAGTATTTGCAATTAAATGAAGG - Intergenic
1172534489 20:35662541-35662563 CAGTCTCTGCATTTTAGGGAGGG + Intronic
1175599853 20:60264432-60264454 CTGTATCTCCAATTTATTCAGGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177979966 21:27900319-27900341 CTGTATCTTCAGTTTGTTGATGG - Intergenic
1178256656 21:31059092-31059114 CAGTCTCTGGTATTTATTCATGG - Intergenic
1178511504 21:33208783-33208805 CAGTATCAGCAAAGTACTGAAGG + Intergenic
1179932179 21:44578362-44578384 CAGTCTCTTCAATTGATAGAGGG - Intronic
1182713933 22:32340247-32340269 CAGTAGCTCCCATTTGTTGAGGG - Intergenic
1183298663 22:37047194-37047216 CAGCAGCTGTCATTTATTGAGGG - Intergenic
950457994 3:13103960-13103982 TAGTATCTTCATTTTATAGATGG + Intergenic
950722932 3:14897750-14897772 TAGTATCTCCATTTGATTGATGG + Intronic
951091991 3:18585123-18585145 CACTGTCTTCAGTTTATTGATGG + Intergenic
952411955 3:33057345-33057367 CAGTCTCTGGTATTTATTTAGGG + Intronic
952916300 3:38246813-38246835 CAGTGTCTGAGGTTTATTGAAGG - Intronic
953819658 3:46194652-46194674 CAGTATCTGAAATAAATTGGAGG + Intronic
955222507 3:57034959-57034981 CACTATCTCCAAATTCTTGATGG + Intronic
955430591 3:58840634-58840656 CAGTACCTGTAATTAATTTATGG + Intronic
956299596 3:67756390-67756412 CAGTAAGTGCAATTTATTTTAGG + Intergenic
956953907 3:74314784-74314806 CATTATATACAATTGATTGAAGG - Intronic
958568414 3:95846447-95846469 CAGTATGTCCATTGTATTGAAGG + Intergenic
959911622 3:111770062-111770084 CAGGATCTTCAATTCATTAATGG + Intronic
960231992 3:115239103-115239125 CAGTTTCTCCAAGTTATTGTGGG - Intergenic
961847346 3:129777240-129777262 TAGTGGCTGTAATTTATTGACGG - Intronic
963534054 3:146505616-146505638 AAACAGCTGCAATTTATTGATGG - Intergenic
964090508 3:152870864-152870886 CAGTATGGGCAATTTAGAGATGG + Intergenic
964435153 3:156643588-156643610 AAATATCTCCAATTTATTCAGGG + Intergenic
964502879 3:157368067-157368089 TATTATCTGCATTTTATAGATGG - Intronic
965019347 3:163207650-163207672 CAATATTTGGAATTTATTCATGG + Intergenic
965440964 3:168713381-168713403 AAGTAGCTGCATTTTGTTGATGG + Intergenic
967590851 3:191272275-191272297 CAGTATCAGCAACTCATTAATGG + Intronic
968792342 4:2675247-2675269 CATTATGTCCAATTGATTGATGG + Intronic
970267319 4:14302645-14302667 TAGTATCTTCAATTTGCTGAGGG - Intergenic
970333906 4:15011931-15011953 AAGTATCTTCAATTAATTCAAGG - Intronic
970552044 4:17191886-17191908 CAGCATCTTTAATTTACTGAGGG - Intergenic
973264268 4:48195628-48195650 TAGCATCTGCAATTTACTGTTGG + Intronic
973709461 4:53613964-53613986 CAGCATCTGTTATTTTTTGACGG + Intronic
974671430 4:65035227-65035249 CAATCTTTGCAATTTATTTAAGG - Intergenic
974700402 4:65436772-65436794 CAGTAGGTGCAAGTTAGTGATGG - Intronic
974809642 4:66929466-66929488 CAGTATGTGAAATTTAGAGAAGG - Intergenic
974809810 4:66931781-66931803 CAGTATGTGAAATTTAGAGAAGG + Intergenic
977098854 4:92782010-92782032 CAGTATCTGGATTTTAATGGAGG + Intronic
979221402 4:118230182-118230204 CAATATCTAAAATTTATTGGAGG - Intronic
979673762 4:123388489-123388511 TAGTATTTGCAATTTTTTCATGG + Intergenic
980319322 4:131248335-131248357 TATTATCTTCATTTTATTGATGG + Intergenic
980635256 4:135493813-135493835 AAGAATGTGCCATTTATTGATGG - Intergenic
981246254 4:142542571-142542593 TAGTATCTGAAATTTATTCCAGG + Intronic
981553747 4:145968626-145968648 CAGTTTCTTAAATTTATTGTAGG + Intergenic
982658608 4:158179059-158179081 CAATATTTGCAGTTTATTTAAGG + Intergenic
982750742 4:159158223-159158245 CAGTTCCTGGAATTTATTGCTGG - Intronic
983249068 4:165325029-165325051 CAATAGCTGTAATTTATTGAGGG - Intergenic
983748461 4:171231811-171231833 CAGTTTCTGCAATGTAGAGAAGG - Intergenic
984103062 4:175510294-175510316 TATTATCTGCATTTTATAGATGG - Intergenic
987302891 5:16612292-16612314 CAGTATGGGCATTTTATTGGTGG + Intronic
988351524 5:30114375-30114397 CAGGGTCTGCAATGAATTGATGG + Intergenic
990108263 5:52291608-52291630 CAGTAACTACCATTTACTGAGGG - Intergenic
990295397 5:54396743-54396765 TAGTATCTTCAATTTATTCAAGG + Intergenic
992664448 5:78993060-78993082 AAGAATCTTCAATTTATTGTTGG + Intergenic
994519830 5:100819402-100819424 CAGTATCTGCCCTTTATGGCAGG - Intronic
994519986 5:100821845-100821867 CAGTATCTGCCCTTTATGGCAGG - Intronic
996007537 5:118441097-118441119 CTGAATCTACAATTTAGTGATGG - Intergenic
998808488 5:145941768-145941790 CATTATCTCCAATTTACAGATGG - Intronic
998867991 5:146524523-146524545 CAGTGTCTGCAATATATAAAAGG + Intergenic
998886275 5:146697793-146697815 CAGTAGTTACTATTTATTGAGGG + Intronic
999488463 5:152024769-152024791 CAGTTTCTTCATATTATTGATGG + Intergenic
1000050317 5:157557290-157557312 CAGTATCTGGAATTGAATCAGGG + Intronic
1000526184 5:162360918-162360940 CAGTTGCTGCAATTTCTAGATGG + Intergenic
1001697782 5:173685212-173685234 CAGAATGTGGAATTTACTGATGG + Intergenic
1002980497 6:2131556-2131578 CAGTATCTTCAATGTATTATGGG - Intronic
1003684402 6:8286971-8286993 CAGTAATTGGAAGTTATTGAAGG - Intergenic
1005658061 6:27964117-27964139 CTGTATTTTCAATTTCTTGATGG + Intergenic
1005889984 6:30129089-30129111 CAAAACCAGCAATTTATTGAAGG - Intergenic
1005914921 6:30343568-30343590 AAGAATCTGCAGTTTACTGAGGG + Exonic
1008068857 6:47079247-47079269 CAGCACATGCGATTTATTGAGGG + Intergenic
1008459171 6:51748019-51748041 CACAATCTGCACTTTTTTGACGG + Exonic
1008583820 6:52930744-52930766 GAAGAACTGCAATTTATTGAAGG + Intergenic
1008771487 6:54984002-54984024 CAGCTTCTGGAATTTATTCATGG + Intergenic
1008812811 6:55525589-55525611 CAGTATGTGTCATTTACTGAAGG + Intronic
1010217947 6:73421455-73421477 CAGTATAAGCAAGTTATTAATGG - Intronic
1011312157 6:85991392-85991414 CAGTATCAGCATTTTATTTAAGG - Intergenic
1014748190 6:125224594-125224616 CAGTATCTGCATTTTAATCTTGG + Intronic
1015585440 6:134771493-134771515 TAGTATCTGCAGTTCCTTGAGGG + Intergenic
1017624730 6:156337008-156337030 TAATAGCTACAATTTATTGAGGG + Intergenic
1020467020 7:8491940-8491962 CAGTAATTGCATTTTATAGATGG - Intronic
1021459804 7:20873486-20873508 AAGTATCTGCCATTTATAAAGGG + Intergenic
1022069740 7:26901061-26901083 CAGTAGCTGCAATTTGATAAGGG + Intronic
1026431020 7:70347426-70347448 CAGTAGATGCTATTTAATGAAGG + Intronic
1027344905 7:77249001-77249023 AAGTATATCCAATTGATTGATGG + Intronic
1027681507 7:81228175-81228197 CAGTATCTGAGAATTATTCATGG - Intergenic
1028981229 7:96970085-96970107 AGGTATCTGCAATTTATAAATGG + Intergenic
1030417461 7:109263293-109263315 CAGTATATGCACTTTATCAATGG - Intergenic
1031880994 7:127198522-127198544 CAGTAGCTAGCATTTATTGAGGG - Intronic
1032211862 7:129922631-129922653 CAGTATTTGCAAATTATAAATGG + Intronic
1032274182 7:130440318-130440340 CACTATACGCAATTTATTAAAGG + Intronic
1034762100 7:153682189-153682211 CATTATTTGCAATTTATGAATGG + Intergenic
1034910555 7:154994642-154994664 CATTGTCTGAAATTTATTTAAGG - Intronic
1035914103 8:3599951-3599973 CGGTCTCTACAATTCATTGATGG + Intronic
1035980279 8:4362530-4362552 CAGGATCTTTAATTTATTGTGGG + Intronic
1036624804 8:10460620-10460642 CAGAATATGCAATTAATTTATGG + Intergenic
1037041549 8:14242296-14242318 CAGTATCTGGCATTGATTAAGGG - Intronic
1037824631 8:22154009-22154031 CAGTGTCTGCAGGTTATTGTTGG + Exonic
1038906919 8:31915148-31915170 CAGTATCTGCCATTTATCTGAGG + Intronic
1039279512 8:35968474-35968496 CAGTATATAACATTTATTGAGGG - Intergenic
1040958233 8:53002724-53002746 CAGTATTTTCAAAATATTGAGGG - Intergenic
1041403510 8:57470210-57470232 CAGAAACTGTAATTTATTGCTGG - Intergenic
1044848774 8:96407765-96407787 CAGTATGGGCAATTTATTGCAGG + Intergenic
1047135599 8:122074613-122074635 ATGTATCTCCAATTTATAGAAGG + Intergenic
1047586001 8:126273393-126273415 CAGAAACTCCAATTTATTGCTGG - Intergenic
1050447796 9:5744707-5744729 CAATAGCTGCAACTTTTTGAGGG - Intronic
1052783595 9:32806615-32806637 CATTATCTTCACTTTATTAATGG - Intergenic
1055097708 9:72431003-72431025 AAGTATCTGAAAGTTATTGCTGG - Intergenic
1056243826 9:84674361-84674383 CTCTATGTGCAATTTATTGTTGG + Intronic
1058721883 9:107771976-107771998 TATTATCTCCAATTTATAGATGG + Intergenic
1059805831 9:117799300-117799322 CAGTATCTGTAAATTATAGTGGG + Intergenic
1060139689 9:121199726-121199748 CAATAACTGCCATTTATTGAGGG + Intronic
1060630158 9:125150226-125150248 CAGTATCTACCATTTACTGAAGG + Intronic
1060955928 9:127639836-127639858 CAATATCTGAAACATATTGAAGG - Intronic
1186009989 X:5119263-5119285 TAGTACCTGGAATTTATGGATGG + Intergenic
1186326369 X:8481756-8481778 TATTATCTACAACTTATTGAAGG + Intergenic
1187510258 X:19911200-19911222 CAGTTTCTGCAAGTGATTGCAGG - Intergenic
1189675487 X:43456784-43456806 CAGGATCTGCAAATTTCTGAAGG - Intergenic
1190019460 X:46860592-46860614 CAGTATCTGAAATTTATTGGTGG - Intronic
1190949416 X:55128207-55128229 CAGTATCTGCAATTTATTGAAGG - Intronic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1195131959 X:101862033-101862055 CAGTATCTCCAATTAAAAGATGG + Intergenic
1195336740 X:103862342-103862364 CAGTATCTGCAGTGTTCTGAAGG - Intergenic
1195829207 X:109037174-109037196 GTGTCTCTGCAATTTATGGAGGG + Intergenic
1196025789 X:111040236-111040258 TAGTATCTGTAATTTAGAGAAGG - Intronic
1198146741 X:133865089-133865111 CTGTAATTGCATTTTATTGAAGG - Intronic
1199088165 X:143653245-143653267 TAGTATCTAATATTTATTGAGGG - Intergenic
1200323236 X:155211930-155211952 CAGTAGCTGAAATTTATTGAGGG + Intronic
1201635897 Y:16122904-16122926 AAGTATATACAATTTATGGAAGG + Intergenic