ID: 1190952117

View in Genome Browser
Species Human (GRCh38)
Location X:55156320-55156342
Sequence TGTTGTGGAGGTTCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190952117_1190952121 11 Left 1190952117 X:55156320-55156342 CCTTTATGTGAACCTCCACAACA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1190952121 X:55156354-55156376 CCTAATACATAGTCTATCCCTGG 0: 1
1: 0
2: 4
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190952117 Original CRISPR TGTTGTGGAGGTTCACATAA AGG (reversed) Intronic
903692331 1:25183448-25183470 TGTTGTGAGGGTTCACGAAATGG - Intergenic
903953797 1:27011633-27011655 GGTCGTTGAGGTTCAGATAAAGG + Intronic
912420447 1:109539131-109539153 TGTTGTGGTGGTTCCCATGGTGG + Intergenic
916490451 1:165297709-165297731 GGTTGTGGAGGGTCTCAGAAAGG - Intronic
917184945 1:172342962-172342984 TGCTATGGAGTTTAACATAATGG - Intronic
917717123 1:177749558-177749580 TGTTGGTGAGGTCCACATTAGGG - Intergenic
919550046 1:198974683-198974705 TGTTAAAGAGGTACACATAAAGG + Intergenic
920120517 1:203653243-203653265 TGTTGTGAAGGTTGACAGAGGGG + Intronic
1065766975 10:29039323-29039345 TGTGGAGGAGCTTCACATGAGGG + Intergenic
1068631841 10:59306330-59306352 TGTTCTGGAGGTTTATCTAATGG - Intronic
1069152390 10:64980325-64980347 TGTTCTGGAGGTTCTAATCAGGG - Intergenic
1070794384 10:79208219-79208241 TGGGGAGGAGGTTCACAGAAAGG - Intronic
1087226662 11:95608307-95608329 TGTTGAGGAGGTTGAAAGAAAGG - Intergenic
1092902084 12:13069544-13069566 TGTTGTGGAGGTTCGCACAGGGG + Intronic
1094640143 12:32266462-32266484 TGTTGTGGCAGCTCACATGAAGG - Intronic
1096831565 12:54318498-54318520 TGTTGTGGAGAATAACAAAATGG - Intronic
1097720539 12:63015497-63015519 TGCTGGGGAAGTTCACAGAAGGG + Intergenic
1097740742 12:63240058-63240080 TGTTCTGGATTGTCACATAATGG - Intergenic
1097794741 12:63849328-63849350 TATTGTGGAGCTACACATATGGG + Intronic
1098079142 12:66765514-66765536 TATTGTGGACTTCCACATAAGGG + Intronic
1100136907 12:91564314-91564336 GGTTGTGTAAGTTAACATAAGGG + Intergenic
1103954006 12:124566830-124566852 TGTTGTGGAGGGGCGCATGAGGG - Intronic
1107254819 13:38412043-38412065 ACTTGTGCAGGTTCACATATAGG - Intergenic
1107480075 13:40779038-40779060 TGTGGTGGAGGTTGACAGCATGG - Intergenic
1108398695 13:50016418-50016440 TGTTTCAGTGGTTCACATAAAGG + Intronic
1110063054 13:71066237-71066259 AGTTTTGGAGGTACACATGAAGG - Intergenic
1113051831 13:106220941-106220963 TGTTGTGTAGATTAACATGATGG - Intergenic
1121669555 14:95697573-95697595 TGTTGTGCAGATTAACATATCGG + Intergenic
1124546060 15:30627626-30627648 TGTTTTGGTGGTTGAAATAAAGG + Intronic
1124779583 15:32617018-32617040 TGTTTTGGTGGTTGAAATAAAGG + Intronic
1124841364 15:33244962-33244984 TGTGGTGGAGGTTCAGAAAAAGG - Intergenic
1129019714 15:72505576-72505598 TGTTGAGCAGGTTCCTATAATGG + Intronic
1130557684 15:84934305-84934327 TGTTGAGGAGGGTCATAGAAAGG + Intronic
1131225370 15:90620592-90620614 TGCTGGGGAGGTTCACAGAGAGG + Intronic
1131359898 15:91781369-91781391 AGCTGTAGAGGTACACATAAGGG - Intergenic
1132036055 15:98485957-98485979 AGTTGTGGCTGTTTACATAAAGG - Exonic
1137449280 16:48555766-48555788 TGTTGTGGATTTTCAAATTAGGG - Intronic
1143619047 17:8070758-8070780 TGCTGTGGATGTTCATATAGGGG - Intergenic
1143855506 17:9845010-9845032 TGTTTTGCAGGTTCAAATTAGGG - Intronic
1146899080 17:36569840-36569862 TGTTTTGGAGTTTCTTATAATGG + Intronic
1147781752 17:42947945-42947967 TGGTGTGAAGGTTCAAATACTGG - Intergenic
1149041358 17:52192928-52192950 TGTTGTGGAGGGTCTCCTAGGGG - Intergenic
1150805412 17:68314954-68314976 TGTTGTGTTGATTCAAATAAAGG - Intronic
1152602077 17:81268604-81268626 TCTTGTGGAGTTTTAAATAAGGG + Intronic
1158283806 18:55856168-55856190 AGTTTTGGAGGTTAACATACTGG + Intergenic
1165222953 19:34332180-34332202 TCTTGTGGAGGCTCAGATGAGGG + Intronic
1167458082 19:49608963-49608985 TGTTGTTGGGGTTGTCATAAGGG + Intronic
926666382 2:15528268-15528290 TGATGTGGGGGTCCAGATAAAGG - Intronic
932148086 2:69342217-69342239 TGGTTTGAAGGATCACATAAAGG - Exonic
932661661 2:73659362-73659384 AGTTCTGGAGGTTCAAACAAAGG - Intergenic
935713451 2:105919126-105919148 TTAAGTGGAGGTTCACACAAAGG - Intergenic
942490051 2:176480875-176480897 TCTTGTGGTGGTTCAGATGAGGG + Intergenic
942848988 2:180460674-180460696 TGTTCCTGAGATTCACATAAAGG - Intergenic
943201248 2:184827637-184827659 TGTTCTAGATGTTCAGATAATGG + Intronic
947718440 2:232353158-232353180 TCTTCTGCAGTTTCACATAAAGG + Intergenic
1177964751 21:27714040-27714062 TGTTTTGGAGATTGACATATGGG - Intergenic
1179276221 21:39894029-39894051 TGTTGTGGAGGGTCCCAAACAGG + Intronic
949596540 3:5553825-5553847 TGTGGTGGACTTTTACATAAAGG + Intergenic
959086990 3:101862038-101862060 TGATTTGGATGTTCATATAAAGG + Intergenic
959245748 3:103865424-103865446 TTTTATGGAGGTTCACTTTATGG - Intergenic
964059091 3:152499878-152499900 AATTGTGGAGGTTAACGTAAGGG + Intergenic
967444040 3:189544119-189544141 TGTGGTGGAAGTTCATATCAAGG + Intergenic
978302172 4:107282792-107282814 TGTTGGGGAGGTTGTCACAAAGG - Intronic
982537935 4:156629727-156629749 TGATGTGCAGGGTCACATGAGGG - Intergenic
985208782 4:187569909-187569931 TGATGAGGAGATTTACATAAAGG + Intergenic
991284747 5:64959953-64959975 TGTTTTGAAGGTTCAAATGAGGG + Intronic
993168744 5:84388311-84388333 GGTTGTGGTGGTGCACAAAAGGG + Intergenic
998145657 5:139726607-139726629 TGTTGTAGGGATTCACAAAAAGG - Intergenic
1000222957 5:159231950-159231972 ATATGTGAAGGTTCACATAAGGG + Intergenic
1006968356 6:38013372-38013394 TGTTTTGAAGGTTCACAGACTGG - Intronic
1007501841 6:42304493-42304515 TCTTGTGGATATTCACATAGAGG - Intronic
1019352237 7:559735-559757 TCTTGTAGAACTTCACATAAGGG - Intronic
1019940637 7:4286562-4286584 TGTTGAGGAGGTGCAGAAAATGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1028842673 7:95444847-95444869 GCTTGAGGAGCTTCACATAACGG - Intergenic
1031343583 7:120636303-120636325 TGTTATGGAGGTTTACTTAAAGG + Intronic
1034704104 7:153124878-153124900 TCTTCTAGAGGTTGACATAAAGG - Intergenic
1040376220 8:46827096-46827118 TGTTGTAGAGTATCACACAATGG + Intergenic
1042157120 8:65856416-65856438 TGTGGTGGAGACTCACAAAATGG + Intergenic
1043782857 8:84358471-84358493 TGTTGTGATGTTTCAGATAAGGG + Intronic
1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG + Intergenic
1044311443 8:90697510-90697532 TGTAGAGTAGGTTCACATAAAGG + Intronic
1044477624 8:92646712-92646734 TGTTGTAGAGGTTAAGAAAATGG + Intergenic
1044891239 8:96838276-96838298 TCTTTTGCATGTTCACATAATGG + Intronic
1051724653 9:20076581-20076603 TGTTCTGGAGGCTTACATCAAGG - Intergenic
1055197360 9:73612588-73612610 TATTGTAAAGGTTCAGATAAAGG + Intergenic
1055941046 9:81650111-81650133 TGTTGTGGAGGTTATTATAAAGG - Intronic
1062728622 9:138095873-138095895 TATTCTGGAATTTCACATAAAGG - Intronic
1190952117 X:55156320-55156342 TGTTGTGGAGGTTCACATAAAGG - Intronic
1193077635 X:77372207-77372229 TGTTGTAGAAGTTCAGAGAAGGG - Intergenic
1193221580 X:78932979-78933001 TGTTCTGGAGGTTCAGAAAATGG + Intergenic