ID: 1190952633

View in Genome Browser
Species Human (GRCh38)
Location X:55161544-55161566
Sequence GAGAGGCGCCGGCCACGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190952633_1190952651 27 Left 1190952633 X:55161544-55161566 CCAGGCCGTGGCCGGCGCCTCTC No data
Right 1190952651 X:55161594-55161616 ACTTAAGTCTCTTCTGCCCGCGG No data
1190952633_1190952641 -9 Left 1190952633 X:55161544-55161566 CCAGGCCGTGGCCGGCGCCTCTC No data
Right 1190952641 X:55161558-55161580 GCGCCTCTCCGTCCTCGGGGGGG No data
1190952633_1190952640 -10 Left 1190952633 X:55161544-55161566 CCAGGCCGTGGCCGGCGCCTCTC No data
Right 1190952640 X:55161557-55161579 GGCGCCTCTCCGTCCTCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190952633 Original CRISPR GAGAGGCGCCGGCCACGGCC TGG (reversed) Intronic