ID: 1190953319

View in Genome Browser
Species Human (GRCh38)
Location X:55167455-55167477
Sequence GGGCAGGTTAATGCAAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 6, 2: 13, 3: 42, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190953319_1190953324 3 Left 1190953319 X:55167455-55167477 CCTCAACTTGCATTAACCTGCCC 0: 1
1: 6
2: 13
3: 42
4: 179
Right 1190953324 X:55167481-55167503 ATGTACATATAATTGAAAGTGGG 0: 1
1: 3
2: 24
3: 145
4: 672
1190953319_1190953323 2 Left 1190953319 X:55167455-55167477 CCTCAACTTGCATTAACCTGCCC 0: 1
1: 6
2: 13
3: 42
4: 179
Right 1190953323 X:55167480-55167502 AATGTACATATAATTGAAAGTGG 0: 1
1: 3
2: 22
3: 155
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190953319 Original CRISPR GGGCAGGTTAATGCAAGTTG AGG (reversed) Intronic
900739032 1:4319272-4319294 GAGCAGGTTAAAGTAAGCTGAGG - Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903901918 1:26653103-26653125 GGGCAACTTAATGTAAGTTCAGG - Intergenic
904346524 1:29875596-29875618 GGGCAGGTTGCTGCAGGTTGTGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
909021990 1:70441658-70441680 GGGCAGCTTGCTGCAGGTTGTGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909491256 1:76229107-76229129 GGGCGGGTTGCTGCAGGTTGTGG - Intronic
910083506 1:83371444-83371466 GGTCAGGCTGATGCAAGATGTGG + Intergenic
910721985 1:90296451-90296473 GGGCATGTTGATGCAAGCTTGGG - Intergenic
912052004 1:105541555-105541577 GGGCAGGCTGATGCAAGAGGTGG + Intergenic
914254386 1:145949496-145949518 GGGAAGTGTAATGCAAGATGAGG + Intronic
916911031 1:169346573-169346595 GAGCAGGGTAATGAATGTTGGGG - Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1068145886 10:53070096-53070118 GGGCTGGAGAATGCATGTTGAGG + Intergenic
1071201518 10:83223993-83224015 GGGCAGGTTATAGGTAGTTGAGG + Intergenic
1071728012 10:88218936-88218958 GGGCAGGTAAATGACAGGTGGGG - Intergenic
1073490419 10:103849591-103849613 GGGCAGGTGAATGGAAGGTCAGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1078002573 11:7509776-7509798 AGCCAGGTCAATGTAAGTTGAGG - Exonic
1079721184 11:23816663-23816685 GGTCATGTTGATGCAAGTGGTGG + Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1081249631 11:40813909-40813931 GGGCATGTTGATGCAAGAGGTGG + Intronic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1081802720 11:45870761-45870783 GGGCAGGATGAAGCAAGTGGGGG - Intronic
1082869281 11:57929188-57929210 GGGGAGGTTTATGAAAGTGGAGG + Intergenic
1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG + Intronic
1089515090 11:119027156-119027178 TGGCTGGTTAATGAATGTTGGGG - Intronic
1090109052 11:123885160-123885182 GGTGAGATTAATGCAAGTTAAGG + Intronic
1091616936 12:2056677-2056699 GAGCAGGTTAAAGAAAGCTGTGG + Intronic
1094622695 12:32095309-32095331 TGTCAGTTTAATGCAAGTTCAGG - Intergenic
1095559725 12:43551465-43551487 GGGGAGGGTAGGGCAAGTTGGGG - Intronic
1095724392 12:45435944-45435966 GGGCAGGTTGCTGCAGGCTGAGG - Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1097021147 12:56021569-56021591 GGGAAGGATAATGTAAGTTCAGG + Exonic
1098510095 12:71301556-71301578 GGGCAGGAAAATGGAAGTTCAGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1105251817 13:18705990-18706012 GGGCATGTTGATGCAAGCTTAGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107021694 13:35758930-35758952 GGGCATGTTGCTGCAGGTTGTGG - Intergenic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107892596 13:44927346-44927368 GGGCAGGTTGCTGCAGGTTGCGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108927462 13:55770302-55770324 GGGCAGGTTGATGCAAGGGCAGG - Intergenic
1109524469 13:63557413-63557435 GGGCATGCTGATGCAAGGTGTGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1113109144 13:106803158-106803180 GCGCAGGTTCCTGCAAGTCGAGG - Intergenic
1116127617 14:40808260-40808282 GGGTAGGGTTATGCAAGTTCAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116485576 14:45444391-45444413 GGGCATGTTGATGCAAGGGGTGG - Intergenic
1116669962 14:47828668-47828690 GGGCATGCTGATGCAAGATGTGG + Intergenic
1117548729 14:56812825-56812847 GGGCAGATTTATGCATGGTGGGG + Intergenic
1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG + Intronic
1118408890 14:65455965-65455987 GGGCTGGATAAAACAAGTTGTGG + Intronic
1120344798 14:83272657-83272679 GGAGTGGATAATGCAAGTTGAGG - Intergenic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1121849302 14:97205249-97205271 AGTCAGTTTAATGCAAGTTTTGG - Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1126065120 15:44820519-44820541 GTGCAGGGGAAGGCAAGTTGGGG + Intergenic
1126094709 15:45080064-45080086 GTGCAGGGGAAGGCAAGTTGGGG - Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1128738467 15:70066899-70066921 GGGCAGGTTACTTCAAGTCCTGG + Intronic
1128912646 15:71530277-71530299 GGGCTGGTTCCAGCAAGTTGAGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130814641 15:87418405-87418427 GGACAGGTTGCTGCAGGTTGTGG + Intergenic
1133207565 16:4242406-4242428 GGTCAAGTTATTGCAAGTTCTGG - Intergenic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1137293558 16:47068766-47068788 GGGCAGTTTAATGGATGCTGGGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139041380 16:63002491-63002513 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1140936371 16:79674307-79674329 AGGCAGGGTAATGCAATGTGTGG - Intergenic
1141619137 16:85227596-85227618 GGGGAGGTTCTTGCAGGTTGGGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142737714 17:1911999-1912021 GGTCAGGTAAATGGAAGATGGGG - Intergenic
1144183391 17:12773282-12773304 AGGCAGGTTGAGCCAAGTTGAGG + Intergenic
1144221369 17:13102773-13102795 GGGTAGGTTGCTGCAGGTTGTGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146602431 17:34229608-34229630 GGGCAGCTAAAGGCAAGGTGGGG - Intergenic
1149182056 17:53951093-53951115 ATGCAGGTTGGTGCAAGTTGTGG - Intergenic
1153347716 18:4046089-4046111 TGGCAGGTTAATGCCAGATGGGG - Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1160471577 18:79139813-79139835 GGGAAGGTTAGTGGGAGTTGTGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164953437 19:32359621-32359643 GGGCTGAGTAATTCAAGTTGGGG - Intronic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
927329191 2:21842125-21842147 GGGCATGCTAATGCAAGAGGTGG - Intergenic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
931483354 2:62665962-62665984 GGAGAGGTTAATGGAAGATGTGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935659696 2:105455574-105455596 GGGTAGGAGAATGCAAGTGGAGG - Intergenic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
943315733 2:186385693-186385715 GGGCATGCTGATGCAAGATGTGG + Intergenic
945446503 2:209943987-209944009 GAGCAGGTTGTTGCAGGTTGTGG + Intronic
946664028 2:222030890-222030912 GAGCAGGTTTAAGCAAGGTGGGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1175250795 20:57609200-57609222 GGGCAGGTCCACGCAAGGTGGGG - Intronic
1175375892 20:58523801-58523823 GCCAAGGTAAATGCAAGTTGGGG + Intergenic
1176837343 21:13805876-13805898 GGGCATGTTGATGCAAGCTTAGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178171026 21:30039923-30039945 GGGCAGGTCAAAGCTAGGTGGGG + Intergenic
1182816875 22:33172031-33172053 GGGCAGGCTGATGCAAGAGGTGG - Intronic
1184153774 22:42653618-42653640 GAGCAGGTTGAGGGAAGTTGGGG + Intergenic
1184292924 22:43507989-43508011 GGGGAGGTTAAAGCAAGCAGAGG - Intergenic
1184579041 22:45400247-45400269 GGGCAGGCTCATACAAGCTGGGG + Intronic
949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG + Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
956947024 3:74234706-74234728 GGTCAGGCTAATGCAAGACGTGG + Intergenic
957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG + Intergenic
958474987 3:94569180-94569202 GGGCATGCTAATGCAAGGGGTGG - Intergenic
958561570 3:95754727-95754749 TGGCAGCTTAGTGCAAGTTTAGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
963391735 3:144673671-144673693 TGGCAAGTTTATGCAAGGTGTGG - Intergenic
966993174 3:185254589-185254611 GGGCAGCTAAAGGCAAGATGGGG - Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
967701179 3:192593882-192593904 AGGCAGAGTAATGCAATTTGAGG - Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
969910569 4:10441574-10441596 AGGGAGGGAAATGCAAGTTGGGG + Exonic
970842267 4:20488437-20488459 GGGCAAGTTAGTAAAAGTTGTGG - Intronic
974457456 4:62146083-62146105 TGGCACGTTAATGCAAGGGGTGG - Intergenic
974953011 4:68604284-68604306 GGTCACGCTAATGCAAGTAGTGG - Intronic
976486975 4:85618277-85618299 GGTCAGGTTCATTCATGTTGTGG + Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
977672801 4:99715547-99715569 GGGCAGGTTTCTACAAGTTGTGG + Intergenic
978774289 4:112490452-112490474 GGTCATGCTAATGCAAGATGTGG + Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
983132787 4:164042957-164042979 GGGCATGCTAATGCAAGGAGGGG + Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985076841 4:186224447-186224469 GGGCATGCTGATGCAAGGTGTGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986481940 5:8198384-8198406 AGGCAGTTTGATGCAAGTTTGGG - Intergenic
986677548 5:10200241-10200263 GGGCATATTAATGCAAGGTAGGG - Intergenic
987744148 5:21948334-21948356 GGGCATGTTAATGCAAGGGGTGG - Intronic
990715336 5:58629973-58629995 GGGAAGGTTGCTGCAGGTTGTGG + Intronic
991764352 5:69958471-69958493 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991782976 5:70159676-70159698 GGGCATGTTAATGCAAGGGGTGG + Intergenic
991843584 5:70833543-70833565 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991875417 5:71160003-71160025 GGGCATGTTAATGCAAGAGGTGG + Intergenic
992758743 5:79933267-79933289 GGGGAGGTTGCTGCAGGTTGGGG - Intergenic
996057829 5:119000150-119000172 GGGCTGGCTAATGGAAGTTATGG - Intergenic
996670888 5:126115520-126115542 GGGCTGGTTGCTGCAGGTTGTGG + Intergenic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999531165 5:152464924-152464946 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
999541149 5:152573515-152573537 GGTCAGGTTGATGCAAGAGGTGG - Intergenic
1000575470 5:162970198-162970220 GGGCATGTTAATGCAAGGGATGG - Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003461620 6:6334067-6334089 GGGCAGGTTGCTGCAGGCTGTGG + Intergenic
1004039349 6:11960543-11960565 GGGCTGGTTGCTGCAGGTTGAGG - Intergenic
1004174671 6:13329022-13329044 GGGCAGGTTGCTGCAGGTTGTGG + Intergenic
1004335804 6:14763302-14763324 GGGCATGTGAATGCATGCTGAGG - Intergenic
1005954279 6:30652771-30652793 AGAAAGGTTAATGCCAGTTGGGG - Intronic
1005992403 6:30911529-30911551 GGGAAGGGGAAAGCAAGTTGTGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1006791239 6:36702666-36702688 GGGCAGCTTCCTGCAAGTGGTGG - Intronic
1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG + Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010810352 6:80292947-80292969 GGTCAGGCTAATGCAAGAGGTGG + Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011169399 6:84489300-84489322 GGGCATGCTAATGCAAGAGGTGG + Intergenic
1013077086 6:106781102-106781124 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016066387 6:139687698-139687720 GGGCACTTTACTGAAAGTTGGGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1016849336 6:148601157-148601179 GGGCTGGTTACTCCAAGTTGTGG - Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1021445415 7:20728444-20728466 GGGCATGTTCATGTAAGTCGTGG + Exonic
1022927352 7:35069790-35069812 GGGCACGCTAATGCAAGGGGTGG - Intergenic
1022966760 7:35481409-35481431 GGGCTGGTGATTGCAAGGTGAGG - Intergenic
1024675945 7:51638074-51638096 GGGCTGGTTAAAGCAGCTTGCGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027300337 7:76827585-76827607 GGTCAGGCTGATGCAAGATGTGG + Intergenic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028147242 7:87331520-87331542 GGGCAGCTAAAAGTAAGTTGGGG - Intergenic
1028248700 7:88514070-88514092 GGGGAGGTGTATGCAAGGTGGGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029049649 7:97671252-97671274 GGGCAAGTTAATGGATGCTGGGG - Intergenic
1030442430 7:109604106-109604128 GGGCAAGTGAATGCATGTTCAGG - Intergenic
1036610631 8:10346881-10346903 GGGCTGGTTGCTGCAGGTTGTGG + Intronic
1036987687 8:13554941-13554963 GAGCAGATTAATGGAAGTGGAGG - Intergenic
1038501127 8:28044758-28044780 GGGCAGGTGGCTGCAGGTTGTGG + Intronic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1042180995 8:66087766-66087788 GGGCATGTTGATGCAAGAGGTGG + Intronic
1042990862 8:74638146-74638168 GGGATGGTTGATGGAAGTTGGGG + Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1047923322 8:129657418-129657440 GGGCAGGTTGATGTAAGGAGTGG + Intergenic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1055778157 9:79788950-79788972 GGGCAGGTTGCTTCAGGTTGTGG + Intergenic
1057774707 9:97997937-97997959 TGCCAGGTTTATGCAAGATGTGG + Intronic
1057911478 9:99023315-99023337 TGGCAGTTAAATGCAAGTAGTGG + Intronic
1061752675 9:132791743-132791765 GGGCAGGTTGCTGCAGGTTGTGG - Intronic
1188662284 X:32775133-32775155 GGGCAGGCTGATGCAAGGGGTGG + Intronic
1188739386 X:33759472-33759494 GGGCAGGGTAATGTGAGTAGAGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193054808 X:77138483-77138505 GAGGAGGGTAATGCAAGTTAAGG - Intergenic
1194107725 X:89792573-89792595 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197040703 X:121932298-121932320 GGGCATGTTGATGCAAGAAGTGG + Intergenic
1197074693 X:122340713-122340735 GGGCACGTTGATGCAAGAGGTGG + Intergenic
1198836035 X:140805765-140805787 GGGCATGTTGATGCAAGAGGTGG + Intergenic
1199289842 X:146093495-146093517 GGGCACGTTGCTGCAAGTGGTGG + Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200459682 Y:3440358-3440380 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic