ID: 1190953319

View in Genome Browser
Species Human (GRCh38)
Location X:55167455-55167477
Sequence GGGCAGGTTAATGCAAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190953319_1190953323 2 Left 1190953319 X:55167455-55167477 CCTCAACTTGCATTAACCTGCCC No data
Right 1190953323 X:55167480-55167502 AATGTACATATAATTGAAAGTGG No data
1190953319_1190953324 3 Left 1190953319 X:55167455-55167477 CCTCAACTTGCATTAACCTGCCC No data
Right 1190953324 X:55167481-55167503 ATGTACATATAATTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190953319 Original CRISPR GGGCAGGTTAATGCAAGTTG AGG (reversed) Intronic