ID: 1190953319 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:55167455-55167477 |
| Sequence | GGGCAGGTTAATGCAAGTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190953319_1190953323 | 2 | Left | 1190953319 | X:55167455-55167477 | CCTCAACTTGCATTAACCTGCCC | No data | ||
| Right | 1190953323 | X:55167480-55167502 | AATGTACATATAATTGAAAGTGG | No data | ||||
| 1190953319_1190953324 | 3 | Left | 1190953319 | X:55167455-55167477 | CCTCAACTTGCATTAACCTGCCC | No data | ||
| Right | 1190953324 | X:55167481-55167503 | ATGTACATATAATTGAAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190953319 | Original CRISPR | GGGCAGGTTAATGCAAGTTG AGG (reversed) | Intronic | ||