ID: 1190957876

View in Genome Browser
Species Human (GRCh38)
Location X:55213927-55213949
Sequence CACTGTGAATGAGGAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190957872_1190957876 25 Left 1190957872 X:55213879-55213901 CCGAAGTATCTCAACTAAGGGCA 0: 1
1: 0
2: 0
3: 17
4: 121
Right 1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190957876 Original CRISPR CACTGTGAATGAGGAGCCTC TGG Intronic
900418812 1:2546833-2546855 CACGGTGAATGAAGAGCAACGGG + Intergenic
903187234 1:21635528-21635550 GACTGTTCCTGAGGAGCCTCTGG + Intronic
903489371 1:23716501-23716523 CACTGTGAATCAGAAGGATCAGG - Intergenic
905802743 1:40855855-40855877 CATCGTGCATGAGGAGCCTGGGG + Intergenic
906791342 1:48660975-48660997 AACTCAGAAAGAGGAGCCTCAGG - Intronic
907327880 1:53652691-53652713 CACAGGGACCGAGGAGCCTCGGG - Intronic
907447486 1:54518107-54518129 CACCAGGAATCAGGAGCCTCAGG + Intergenic
907803387 1:57794019-57794041 CAAGATCAATGAGGAGCCTCAGG - Intronic
910982633 1:92974262-92974284 CACTGTGAAAGAACAGCCTCAGG - Intergenic
911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG + Intronic
915006934 1:152646920-152646942 CACAGAGAATGAGGAAACTCAGG - Intergenic
916376148 1:164155417-164155439 CACTGGAAATGAGGAGGCCCTGG - Intergenic
920735840 1:208532521-208532543 CACTCTGGAAGTGGAGCCTCTGG - Intergenic
921329846 1:214024609-214024631 CAATGTGAGTAAGGAGCCTAGGG - Intronic
922574997 1:226655446-226655468 CCCTAGGATTGAGGAGCCTCTGG - Intronic
924188783 1:241525705-241525727 CATTGTGTTGGAGGAGCCTCAGG - Intergenic
1063580303 10:7300478-7300500 CACACTGAATGAGAAGCCTGAGG - Intronic
1064042717 10:11982316-11982338 CACTGGGAGTGAGGAGACCCAGG + Intronic
1064185461 10:13158392-13158414 AACTGTGGATGAGGAACCTACGG - Intergenic
1065785586 10:29210942-29210964 CACTGTGAAAAAGCAGTCTCAGG - Intergenic
1066088217 10:31991689-31991711 CACAGTGAAAGAAGAGCATCTGG + Intergenic
1070670586 10:78374685-78374707 CACTGTCAGTGAGGTGCTTCTGG + Intergenic
1070788669 10:79176980-79177002 CACTGGGAATGAGGCCCCTCAGG + Intronic
1072481611 10:95814495-95814517 AACTGTGGGTGGGGAGCCTCAGG + Intronic
1072994208 10:100229122-100229144 CTCTGTGAATGTGGAGTGTCAGG - Intronic
1073029828 10:100516842-100516864 CACTGTGAATTAGGATCCACTGG - Intronic
1073903866 10:108254308-108254330 CACTGTGACTCAAGAGCTTCAGG - Intergenic
1073939136 10:108673828-108673850 CACTGTAAGTGTGGAGCATCTGG - Intergenic
1074713166 10:116194098-116194120 AACCTTAAATGAGGAGCCTCAGG + Intronic
1076109225 10:127848538-127848560 CACTGTGAAGGCCCAGCCTCAGG - Intergenic
1077243753 11:1525720-1525742 CACTGTGAGTGTGGAGACCCAGG - Intergenic
1078188596 11:9073350-9073372 CGCTGAGAATGAGCAGGCTCTGG + Intronic
1082649783 11:55775560-55775582 CACAGTGACTGAGGAGGCTGAGG + Intergenic
1083954674 11:65976844-65976866 CACTCTGGATGAGGAGGCTGAGG - Intronic
1086549477 11:88039513-88039535 CACAGGGACTTAGGAGCCTCTGG + Intergenic
1087092561 11:94288776-94288798 TCCTGGGAATGAGGAGCCTGAGG + Intergenic
1087218377 11:95519262-95519284 TACTTTGAATGAGGGTCCTCAGG - Intergenic
1088581226 11:111318866-111318888 TACTGTGAATTAGGATCTTCTGG - Intergenic
1088821503 11:113461175-113461197 CCCTGTAAATGAGGATCCTGTGG - Intronic
1089319533 11:117615603-117615625 CACTGGGAATGAGGAACAGCTGG - Intronic
1091086565 11:132727010-132727032 CAGTGTGTGTGAGGAGCTTCAGG - Intronic
1091166288 11:133479275-133479297 CACTGTGCGTGAGAATCCTCTGG - Intronic
1091257583 11:134203651-134203673 CACTGTTAATCAGGAGCTCCAGG + Exonic
1094168785 12:27469341-27469363 CCCTGTGAAAGAGAAGCATCAGG - Intronic
1099680228 12:85818615-85818637 GACTGTGTATGATGAGCCACTGG - Intronic
1104356574 12:128091998-128092020 CACTTAGAATGAAGAGACTCAGG + Intergenic
1104644024 12:130484479-130484501 CACTGGGGATGAGGATGCTCAGG - Intronic
1104760512 12:131295247-131295269 CACTGTGACTGGGGACCCCCAGG - Intergenic
1104819263 12:131665538-131665560 CACTGTGACTGGGGACCCCCAGG + Intergenic
1108522577 13:51259320-51259342 CTCTGTGGATGAGCAGCCGCTGG - Intronic
1110380541 13:74845079-74845101 CAATGTGAATGAGCACCATCCGG - Intergenic
1110616492 13:77547834-77547856 CTCTGTTAATGACTAGCCTCAGG + Intronic
1113189017 13:107722431-107722453 CACTGAAAATGAGGAGCCTCAGG + Intronic
1113613795 13:111666401-111666423 TACTGGGAGTGAGGGGCCTCTGG - Intronic
1115757519 14:36544185-36544207 CTCTGTGAACAAGGACCCTCCGG - Intergenic
1120917276 14:89721143-89721165 CACCGTGAATAAAGAGCTTCGGG - Intergenic
1122679302 14:103445289-103445311 GACTGTGAATGTGAAGCATCTGG + Intronic
1122814255 14:104304512-104304534 CCCTGGAAATGAGGAGCATCTGG - Intergenic
1126633065 15:50756915-50756937 CACTGAGAATGAGGTGCTTGGGG - Intronic
1126858525 15:52861825-52861847 CAGTGTAAAACAGGAGCCTCTGG - Intergenic
1126978907 15:54218781-54218803 CACTATTGATGAGGAGCTTCAGG + Intronic
1127006089 15:54571704-54571726 CACTCTGCCTGAGGAGCCACAGG + Intronic
1129606470 15:77027690-77027712 CACTGTGAAGCAGCAGGCTCTGG + Intronic
1129959265 15:79668543-79668565 CACAGTTATTGAGGAGCATCTGG - Intergenic
1130721240 15:86387360-86387382 CACTTTCAATGAGGAGACTAAGG + Intronic
1132540773 16:508232-508254 TGCTGTGACTGAGGAACCTCTGG + Intronic
1133081384 16:3323394-3323416 CACAGTGATTGAGGAGCACCTGG - Intergenic
1133317024 16:4891229-4891251 GAGTGTGAATAAGGGGCCTCAGG + Intronic
1133404095 16:5509342-5509364 CCCTGTGAATGAGGAGAAGCGGG + Intergenic
1133421077 16:5647400-5647422 CACTGTGAAATAGGATCCTTTGG + Intergenic
1133623708 16:7550471-7550493 CATTTTTAATGAGGAGCCTGGGG + Intronic
1134035503 16:11027533-11027555 CACAGTGATTGAGGAGCACCTGG + Intronic
1134894882 16:17876239-17876261 CATTGTGAATGAGCAGCCCAGGG - Intergenic
1140034887 16:71364449-71364471 CACTGTTCTTGAAGAGCCTCAGG - Intronic
1142845691 17:2674014-2674036 CACTGTGAATGACAATCATCAGG - Intronic
1142902305 17:3019732-3019754 TCCTGTGGATGAGGAGACTCAGG + Intronic
1143125507 17:4639106-4639128 CACTGTGGGCGAGGACCCTCAGG - Exonic
1145971519 17:28959220-28959242 GCCTGTGAAGGAGGAGCGTCAGG + Exonic
1146544233 17:33724586-33724608 AATTGGGAATGAGGAGCCTAAGG + Intronic
1146977263 17:37124637-37124659 CACTGGGACTGAGAAGCCTGGGG + Intronic
1148516184 17:48220055-48220077 CAGTGAGAATGAGGAGCAACTGG + Intronic
1149618430 17:58022034-58022056 CCCAGTGAATCAGGAGCCTGAGG - Intergenic
1151788394 17:76287905-76287927 CCCAGTGAATGAGGAGGGTCAGG + Intronic
1152703304 17:81830165-81830187 CACTTTGAATGAGGATGCTGAGG - Intronic
1154018336 18:10639591-10639613 CACTGTGAGTCAGGAGCCATTGG + Intergenic
1156255293 18:35389652-35389674 CACTGTGAAGAAGGACTCTCTGG - Intergenic
1158550155 18:58429195-58429217 CATTTTGAAAGAGGAGCCTCTGG - Intergenic
1159296339 18:66494207-66494229 CACTGGGATTGAGTAGCCACTGG + Intergenic
1159457096 18:68673026-68673048 CACTGTGTGTGTGGAGGCTCCGG - Intergenic
1160518667 18:79491972-79491994 CACTGGGCGTGAGGAGCCCCGGG - Intronic
1161389775 19:4014985-4015007 CACTTGGAAGGCGGAGCCTCAGG - Intronic
1161475560 19:4482947-4482969 CTCAGAGAATGAGGAGCCCCGGG - Intronic
1163695019 19:18759744-18759766 CCCTGGGAATGAGGTGCCTGAGG - Intronic
1164104648 19:22097883-22097905 CATAGTGAATGATCAGCCTCTGG + Intergenic
1164217954 19:23167484-23167506 CACAGTGAATGATTAGCCTCTGG + Intergenic
1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG + Intronic
1167586357 19:50377773-50377795 CACTGTAAAGGAGGAGGGTCCGG + Exonic
1168426760 19:56245338-56245360 CTCTGTGAATGAGATGCGTCCGG + Exonic
925005986 2:443362-443384 CACTGTGAGTGACGAGACGCAGG - Intergenic
926143988 2:10385708-10385730 CCCTGCAAATGAGCAGCCTCTGG - Intronic
927759801 2:25742736-25742758 CACAGTGAAAGAGGAGCCCCAGG - Exonic
932000477 2:67880112-67880134 CACTGTGAATCAGAAACCTAGGG + Intergenic
933256935 2:80091871-80091893 CTCTGTGAAACAGGATCCTCTGG + Intronic
934036007 2:88088877-88088899 CCCGGTGGATGAGGAGGCTCAGG + Intronic
936448463 2:112615530-112615552 CACCGTGTTTCAGGAGCCTCGGG + Intergenic
937338959 2:121078813-121078835 CACATTCAATGAGGAGCCACAGG - Intergenic
937510389 2:122588808-122588830 CACTGTCAACGTGGATCCTCAGG + Intergenic
938168882 2:129057453-129057475 CACTTTCGATGAGGTGCCTCAGG - Intergenic
938200831 2:129371756-129371778 CACTGTGTAGGAGCAGCCCCAGG + Intergenic
942534513 2:176949201-176949223 CAACTTGAATGAGGATCCTCTGG + Intergenic
944783149 2:203040617-203040639 CACAGTGATTGAGGAGCACCTGG + Intronic
946379447 2:219335327-219335349 CACTGTGGAGGGGGAGCCCCTGG - Intergenic
947252385 2:228122332-228122354 CACTGTGTGTGAAGAGCCCCTGG - Intronic
948469289 2:238166990-238167012 CACTGTGAGGGAGCAGCCGCTGG - Exonic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169016399 20:2296215-2296237 CACTGAGAAAGAGCCGCCTCTGG - Intronic
1172848458 20:37944294-37944316 CAGAGTGCATGAGGAGCCGCCGG + Exonic
1175339167 20:58216942-58216964 CACAGTGAAGGAGTAGCCACGGG - Intergenic
1176705878 21:10119775-10119797 CCCGGTGAAGGAGGAGCTTCGGG + Intergenic
1178240265 21:30891612-30891634 GAGTCTCAATGAGGAGCCTCAGG - Intergenic
1179207826 21:39300136-39300158 CACTGTAACTGAGGCGCCTTAGG - Intronic
1184088522 22:42280350-42280372 CACTGTAAATGAGCTGCCTGGGG - Intronic
950577574 3:13842011-13842033 CAGTGTGTGTGAGGAGCCACAGG + Intronic
953669281 3:44948912-44948934 CACTGAGGATGAGGAGCCAAAGG + Intronic
953890160 3:46745310-46745332 ACCTGTGAATGAGGGGCCTCTGG - Intronic
954388191 3:50255323-50255345 AACTGGTAATGAGGAGCCCCTGG + Intronic
954432132 3:50476384-50476406 CACAGTGCATGAGGAGCACCTGG - Intronic
957669427 3:83281261-83281283 CACTGTGAGTGTGCAGCCTAAGG - Intergenic
958442072 3:94167497-94167519 CACTTAGAATGAGGAACCTAAGG + Intergenic
958900473 3:99880133-99880155 AACTGTGAATGTGGAGCCAAAGG + Intronic
960829930 3:121835388-121835410 CGCTGTGAGTGAGGACCATCCGG + Exonic
962933276 3:140056989-140057011 CCCTGTGCAGGAGGAGGCTCTGG - Intronic
962937750 3:140096724-140096746 AACTCTGAATCAGGAGCCTGGGG - Intronic
966678106 3:182611182-182611204 CACAGCGATTGAGGAGCATCTGG + Intergenic
969034916 4:4245304-4245326 CCCTGTGAATGAGGAACTACTGG + Intronic
969782735 4:9422215-9422237 CACTGAGCAAGAGGAACCTCAGG + Intergenic
970825326 4:20266134-20266156 CACAGTGAATTAGGAACCACTGG + Intronic
972222528 4:36972436-36972458 CACTGTGAAAGAAGTGTCTCTGG + Intergenic
972905974 4:43747472-43747494 CAATGGCAATCAGGAGCCTCTGG - Intergenic
975702788 4:77082605-77082627 CACAGTGATTGAGGAGCACCTGG - Intergenic
978255044 4:106682823-106682845 TACTGTGATTGTGGAGTCTCTGG - Intergenic
978598049 4:110399981-110400003 CACAGTGATTGAGGAGCACCTGG - Intronic
984330882 4:178316349-178316371 CACTGTGTGTGAGGAGACACAGG - Intergenic
984474014 4:180214773-180214795 CACTGTGACAAAGGATCCTCAGG - Intergenic
984642058 4:182177458-182177480 AACAGTGAATCAGGAGCATCAGG - Intronic
985705237 5:1396640-1396662 CGCTGTGAATGAGGAGGCTGGGG + Intronic
986010228 5:3707281-3707303 CACTGTGACGGAGGAGTCTGTGG + Intergenic
987656102 5:20808109-20808131 CACTGTGAAATAAGAGCCACTGG + Intergenic
988269993 5:29001945-29001967 CACTGTGAATGAAGAACTTGAGG + Intergenic
989132177 5:38118347-38118369 CACTATGAATGAGAAACATCTGG - Intergenic
990685363 5:58294826-58294848 CACTGTGCCTTAGCAGCCTCTGG - Intergenic
992031483 5:72725923-72725945 CACAGTGATTGAGGAGCACCTGG + Intergenic
993593863 5:89828184-89828206 CACTCTCAAAGTGGAGCCTCGGG + Intergenic
997832004 5:137158217-137158239 AAATGTGAAGGAGGAGCCCCAGG + Intronic
998416951 5:141952970-141952992 CACTGTGACTTGGGAGACTCGGG + Intronic
998577527 5:143333008-143333030 CACAGTGATTGAGGAGCACCTGG + Intronic
998662183 5:144251355-144251377 CACTGTAAATGAGGAAACTGAGG - Intronic
999434948 5:151556246-151556268 CACTGTGGCTGAGGAGGGTCTGG - Intronic
1001764932 5:174238204-174238226 CTCTGAGAATGAGGAGGCTCTGG + Intronic
1002438247 5:179246938-179246960 CATTTTGAATGTGGAGACTCTGG - Intronic
1002490469 5:179572572-179572594 CACTGTTAATGATTTGCCTCTGG + Intronic
1003733583 6:8853068-8853090 AGATGTGAATGAGGAGCGTCAGG - Intergenic
1005457476 6:26034743-26034765 AACACTGAATGAGGAGTCTCTGG + Intergenic
1005520040 6:26592731-26592753 CACTGAGAGTCAGGAGGCTCTGG + Intergenic
1005599496 6:27411953-27411975 CGGGGTGGATGAGGAGCCTCTGG + Intergenic
1006816740 6:36856259-36856281 CACAGTTAGTGAGGAGCATCAGG - Intronic
1007229644 6:40339432-40339454 CACTGGGAAAGATGAGTCTCTGG + Intergenic
1007393154 6:41562046-41562068 CACTGTGGGTGAGCAGGCTCTGG - Intronic
1009342626 6:62575985-62576007 AACTGTAAATTAGCAGCCTCTGG - Intergenic
1013189054 6:107786406-107786428 GACTGTGGGGGAGGAGCCTCTGG - Intronic
1013198682 6:107869063-107869085 CACTGTGTATGGGGAAGCTCAGG - Exonic
1013353529 6:109327384-109327406 CACAGTGATTGAGGAGCACCTGG - Intergenic
1013579423 6:111518356-111518378 CTTAGTGAATGAGAAGCCTCTGG - Intergenic
1014760995 6:125356581-125356603 GACTGAGAATGAAGAGCCACTGG + Intergenic
1015546438 6:134366566-134366588 CAGTGGGAATTAGGAGACTCTGG - Intergenic
1017640898 6:156492808-156492830 CATTGTGAATGAGGACCCAATGG + Intergenic
1017773970 6:157665394-157665416 TACTTTGAAGGAGGAGCCTCTGG + Intronic
1017950828 6:159133271-159133293 CACTGTGAATGACGAGCGAAGGG - Intergenic
1018854534 6:167666214-167666236 GACTGGGATGGAGGAGCCTCAGG + Intergenic
1019924686 7:4184390-4184412 ACCTGTGAGTGAGGAGACTCAGG + Intronic
1020440502 7:8212042-8212064 CACTTTCAAAGAGGAGCCTTTGG - Intronic
1022345899 7:29514515-29514537 GAAAGTGAATGTGGAGCCTCAGG - Intergenic
1023640598 7:42253267-42253289 CACTGTGAACAAGGTGCTTCTGG - Intergenic
1025028194 7:55535227-55535249 CACAGTGAATGGGGAGCCCCTGG - Intronic
1027178825 7:75923213-75923235 CACAGTGATTGAGGAGCACCTGG + Intronic
1029918705 7:104239156-104239178 CACTGTGAATCAGGAGTCTTTGG - Intergenic
1032712510 7:134473089-134473111 CACTAAGACTGAGGAGCCCCGGG - Intergenic
1034712208 7:153203615-153203637 CCCAGTGAAATAGGAGCCTCAGG + Intergenic
1035736612 8:1892084-1892106 AACTGTGACTCAGGAGCCTTGGG + Intronic
1036836332 8:12071819-12071841 CACTGAGCAAGAGGAACCTCAGG - Intergenic
1036858174 8:12318388-12318410 CACTGAGCAAGAGGAACCTCAGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038240247 8:25801487-25801509 AATTGTGTATGCGGAGCCTCAGG + Intergenic
1038693906 8:29788071-29788093 CACTGTAAAAGGAGAGCCTCAGG + Intergenic
1039358427 8:36847026-36847048 CAAAGTTAATGAGGAACCTCAGG - Intronic
1039637149 8:39179531-39179553 CACAGAGAGTGTGGAGCCTCAGG - Intronic
1039822401 8:41145696-41145718 GACTGTGAAAGAGAAGCTTCTGG - Intergenic
1040019279 8:42725699-42725721 CACAGTGATTGAGGAGCACCTGG - Intronic
1041087493 8:54270353-54270375 CACTGTGCATGATGACACTCTGG + Intergenic
1041130708 8:54696907-54696929 CACAGTGATTGAGGAGCACCTGG + Intergenic
1043739414 8:83791320-83791342 CACTATGAATGAGTAGTCTTAGG + Intergenic
1047205455 8:122799684-122799706 CTCTGTGACTGAGGAGCTCCTGG + Intronic
1048316240 8:133364576-133364598 CACTGTGCATGTGGAGCCTGAGG - Intergenic
1048868574 8:138778797-138778819 AAGTGTGAATGATGAGCCACAGG - Intronic
1049317813 8:141978694-141978716 CACTGTGAAGAAGCGGCCTCTGG - Intergenic
1053643159 9:40106894-40106916 CTCGGTGAAGGAGGAGCTTCGGG + Intergenic
1053762990 9:41358595-41358617 CTCGGTGAAGGAGGAGCTTCGGG - Intergenic
1054324011 9:63704122-63704144 CCCGGTGAAGGAGGAGCTTCGGG + Intergenic
1054541596 9:66269709-66269731 CTCGGTGAAGGAGGAGCTTCGGG - Intergenic
1055035405 9:71812914-71812936 GACTGTGAATTAGGAGCCCTGGG + Intronic
1055620973 9:78124950-78124972 CACTGTGAAGGAGGAACTACTGG - Intergenic
1059342262 9:113604136-113604158 CACTGTGATTGATAAGCCTGGGG - Intergenic
1059423321 9:114206038-114206060 GACTGAGTAGGAGGAGCCTCTGG - Intronic
1060051188 9:120379561-120379583 CTCTGTGCAGCAGGAGCCTCAGG + Intergenic
1061557099 9:131377610-131377632 CACTGTGGATGTGGAGCCCAGGG - Intergenic
1202790912 9_KI270719v1_random:89864-89886 CCCGGTGAAGGAGGAGCTTCGGG + Intergenic
1187250993 X:17597847-17597869 CCTAGTGAATGAGGAGCCTGAGG - Intronic
1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG + Intronic
1192362248 X:70447224-70447246 CACTGGGAACGGGAAGCCTCTGG + Intronic
1193439424 X:81520124-81520146 AACTCTGTATGAGGAGACTCAGG + Intergenic
1193894914 X:87101049-87101071 CACTCTGAATGAAGGGCCTTGGG + Intergenic
1196244462 X:113383777-113383799 CACAGAGAATGAGCAGCCTTTGG + Intergenic
1199497148 X:148465197-148465219 CACAGTGATTGAGGAGCACCTGG + Intergenic
1200228579 X:154432754-154432776 GAGTGTGACTGAGAAGCCTCGGG + Intronic