ID: 1190962259

View in Genome Browser
Species Human (GRCh38)
Location X:55264463-55264485
Sequence CACCTCGCCCTGCCACTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 522}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190962254_1190962259 -8 Left 1190962254 X:55264448-55264470 CCCTTCCTTACTGCCCACCTCGC 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962248_1190962259 17 Left 1190962248 X:55264423-55264445 CCCGCAGTGTTCCTAGTTTCCAG 0: 1
1: 0
2: 1
3: 9
4: 234
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962253_1190962259 -7 Left 1190962253 X:55264447-55264469 CCCCTTCCTTACTGCCCACCTCG 0: 1
1: 0
2: 2
3: 23
4: 326
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962252_1190962259 -2 Left 1190962252 X:55264442-55264464 CCAGGCCCCTTCCTTACTGCCCA 0: 1
1: 2
2: 6
3: 60
4: 555
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962249_1190962259 16 Left 1190962249 X:55264424-55264446 CCGCAGTGTTCCTAGTTTCCAGG 0: 1
1: 0
2: 2
3: 19
4: 243
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962255_1190962259 -9 Left 1190962255 X:55264449-55264471 CCTTCCTTACTGCCCACCTCGCC 0: 1
1: 0
2: 1
3: 34
4: 383
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522
1190962251_1190962259 6 Left 1190962251 X:55264434-55264456 CCTAGTTTCCAGGCCCCTTCCTT 0: 1
1: 6
2: 5
3: 33
4: 429
Right 1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG 0: 1
1: 0
2: 4
3: 56
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190962259 Original CRISPR CACCTCGCCCTGCCACTGCC CGG Intronic
900114139 1:1021315-1021337 CACCAGGCCCTCCCCCTGCCTGG + Intronic
900180232 1:1308002-1308024 CACCGCCCGCTGTCACTGCCGGG + Exonic
900269954 1:1782037-1782059 CACAGCGCCCGGCCACAGCCTGG + Intergenic
900402505 1:2478303-2478325 CACACCGCCCTGCCAGTGACAGG - Intronic
900755615 1:4432563-4432585 CATCCCTCCCTGCCTCTGCCAGG - Intergenic
901228664 1:7629876-7629898 CAGCTCGAGCTGCCACTGCCAGG - Intronic
901680500 1:10910128-10910150 CACCCCACCCTGCCCCTACCAGG - Intergenic
902342219 1:15791394-15791416 CACCGCGCCCGGCCCCTACCTGG - Intergenic
902466244 1:16620383-16620405 GTCCTGGCCCAGCCACTGCCTGG - Intergenic
903488114 1:23706642-23706664 CACCATGCCCGGCCTCTGCCTGG - Intergenic
903834684 1:26195788-26195810 CACCGCGCCCGGCCTATGCCAGG + Intronic
904044883 1:27603172-27603194 CACCTCCCCCTCCCCCTTCCCGG + Intronic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
904791398 1:33024638-33024660 AACCTGGCCCTGCCACTTACTGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905394107 1:37656212-37656234 CACCATGCCCAGCCCCTGCCTGG - Intergenic
906256579 1:44355159-44355181 GAGCTGGCCCTGCCTCTGCCTGG - Exonic
906345454 1:45011707-45011729 CCCCTTCCCCTGCCACTGACAGG + Intergenic
906508580 1:46397849-46397871 CACCGCGCCTGGCCAATGCCTGG + Intronic
906625883 1:47325258-47325280 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
907162062 1:52378056-52378078 CACCGCGCCCCGCCCCAGCCCGG - Intronic
907288063 1:53394654-53394676 CCCCTCGCTCTACCACTGCTTGG + Intergenic
907425872 1:54379001-54379023 CTCCTGGCCCCGCCACCGCCTGG + Intronic
907940181 1:59079986-59080008 CAACTCCCCCTGCCCCTGCTGGG - Intergenic
908160860 1:61407254-61407276 AACCTCACCATGCGACTGCCAGG - Intronic
908639498 1:66206135-66206157 CACCATGGCCTGCCACTGCTAGG + Intronic
908766620 1:67560097-67560119 CACCGCGCCCAGCCAATGGCAGG - Intergenic
912038626 1:105355434-105355456 CACCTCGCCCGGCCAATTTCAGG - Intergenic
913127882 1:115810006-115810028 CCCCTGGCCCTGCCACTTCCTGG - Intergenic
913192845 1:116428154-116428176 CTCCTCGCTCTGCCACTGAAAGG - Intergenic
914253850 1:145944737-145944759 CACCTCGCCCAGCCAGGGGCAGG - Intronic
914424433 1:147562038-147562060 CACCACGCCCGGCCTCTACCAGG - Intronic
914822675 1:151116896-151116918 CACCTTGCCCTGCCATTTCTGGG + Intronic
914918137 1:151830810-151830832 CACCTCCCCTTGCTCCTGCCTGG + Intronic
915074508 1:153297429-153297451 CCCCTCTCCCCGCCTCTGCCTGG - Intergenic
915338373 1:155161717-155161739 CACCACGCCCGGCCCATGCCTGG + Intergenic
915512990 1:156396894-156396916 CACCGCGCCCGGCCCATGCCTGG + Intergenic
915911801 1:159920101-159920123 CACCTCAGTCTTCCACTGCCTGG + Intronic
917660406 1:177171841-177171863 TCCCTCTGCCTGCCACTGCCAGG - Intronic
918046794 1:180946389-180946411 GACTTCTCCCTGCCATTGCCTGG - Exonic
919761578 1:201101531-201101553 CACCCGGCCCTGCCCCAGCCGGG - Intronic
919926433 1:202194094-202194116 CCCGGCCCCCTGCCACTGCCAGG + Exonic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
920512245 1:206559838-206559860 CACCCAGCCCTGCCCCTCCCTGG - Intronic
921186245 1:212671906-212671928 CACCTCCCCCTGCCTGTGCGGGG - Intergenic
921212954 1:212915659-212915681 CACCGAGACCTCCCACTGCCTGG + Intergenic
921498509 1:215870541-215870563 CACCTCGGCCTCCCACTGCTGGG + Intronic
922420071 1:225453708-225453730 CACCTGGCCCTGCCCTTGACAGG + Intergenic
923017814 1:230140353-230140375 TTCCTACCCCTGCCACTGCCTGG + Intronic
923280431 1:232438102-232438124 CCCCTCACCCCACCACTGCCAGG - Intronic
923481191 1:234385746-234385768 CACCTCGGCCTCCCAATGCTAGG + Intergenic
923730382 1:236544199-236544221 CACTTCGCCCTCCCAGTGCTGGG + Intronic
1063371882 10:5527532-5527554 CACCCCTCCCTGCCACTCTCAGG + Intergenic
1063449593 10:6142606-6142628 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1063592727 10:7408859-7408881 CACATCCCCCGGCGACTGCCCGG + Intronic
1065056077 10:21843916-21843938 CACCTCACCCTGCCCTTGACAGG - Intronic
1065694770 10:28369771-28369793 CACCGCGCCCAGCCCCTGTCTGG - Intergenic
1066090622 10:32015549-32015571 CACCTCGCACTGCCACTGGCTGG + Exonic
1066434489 10:35384613-35384635 CACCCCGCCCCTCCACTGCAGGG - Intronic
1066687346 10:37993570-37993592 CCCATCCCCATGCCACTGCCTGG + Intergenic
1067487089 10:46660841-46660863 CACCTCTACCTGCTACTGCCTGG + Intergenic
1067607714 10:47681135-47681157 CACCTCCACCTGCTACTGCCTGG - Intergenic
1068380174 10:56242870-56242892 CACCACGCCCAGCCCCAGCCAGG + Intergenic
1069250015 10:66256075-66256097 CACCTGCCCCTGCCTCTGTCTGG - Intronic
1069378975 10:67822737-67822759 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1070554078 10:77514689-77514711 CCACCCACCCTGCCACTGCCAGG - Intronic
1071336038 10:84601239-84601261 CATCTCTCACAGCCACTGCCTGG + Intergenic
1071623272 10:87142532-87142554 CACCTCCACCTGCTACTGCCTGG - Intronic
1072552199 10:96487529-96487551 CCCCTACCCCTGCCAATGCCTGG - Intronic
1073057267 10:100710512-100710534 CCCCCCGCCCTGCGCCTGCCCGG - Intergenic
1073063848 10:100747034-100747056 CATCTTTCCCTGCCTCTGCCTGG + Intronic
1074014523 10:109520410-109520432 CATCTCGCTCAGCCACTGTCTGG - Intergenic
1074976506 10:118586210-118586232 CACCACCCCCAGCCAATGCCTGG - Intergenic
1075258224 10:120942151-120942173 CACCGCGCCCTGCCGCTCACAGG - Intergenic
1075675059 10:124290478-124290500 CCCCTGGCCCTGCTACTTCCTGG - Intergenic
1076279334 10:129232521-129232543 CCCCTGCCCCTGCCCCTGCCCGG + Intergenic
1076427528 10:130378387-130378409 CTCCTGGTCCTCCCACTGCCTGG + Intergenic
1076441591 10:130484475-130484497 CACCTCCCCAGGCCACTTCCTGG - Intergenic
1076754689 10:132563070-132563092 CACCTCGCAGTCCCTCTGCCTGG - Intronic
1077474551 11:2780215-2780237 GTCCTTGCCCTGCCACTGACTGG + Intronic
1078216720 11:9318009-9318031 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1079281348 11:19089795-19089817 CACCGCGCCCGGCCAGAGCCTGG - Intergenic
1080012329 11:27472004-27472026 CACCCCGCCCCGCCGCCGCCCGG - Intronic
1081705802 11:45181296-45181318 CCCCTCACCCTGGGACTGCCGGG - Intronic
1081760622 11:45574322-45574344 CTCCTGGCCCTGCCACTGACTGG - Intergenic
1081811101 11:45914504-45914526 CACCTTCCCCTGCCCCAGCCTGG - Intronic
1082283641 11:50298140-50298162 CACCTCCCCCAGCCAGGGCCCGG - Intergenic
1083024953 11:59542888-59542910 CACCATGCCCGGCCAATGCCCGG - Intergenic
1083304376 11:61754920-61754942 CACCAGGCCCTGCCACTCCCAGG - Intronic
1083720833 11:64602760-64602782 CCCCTGGCCTTGCCGCTGCCAGG - Intergenic
1084084165 11:66847289-66847311 CACCACGCCCCGCCTATGCCCGG - Intergenic
1084130391 11:67129444-67129466 CACCGCGCCCGGCCTATGCCCGG - Intronic
1084154817 11:67307624-67307646 CACCTGGGCCAGCCACTACCAGG + Exonic
1084267219 11:68011211-68011233 CCCCCTGCTCTGCCACTGCCTGG - Intronic
1084361381 11:68670384-68670406 CACCCCGCCCTGCCTCTTGCTGG + Intergenic
1084507964 11:69581481-69581503 CACCCCCCGCTGCCAGTGCCAGG - Intergenic
1084774142 11:71364482-71364504 CCACTCTCCCTGCCCCTGCCAGG - Intergenic
1084959141 11:72707129-72707151 AACCCCGCCATGCCTCTGCCTGG + Intronic
1085340862 11:75730620-75730642 CACCACGCCCAGCCAGTGGCTGG - Intronic
1085529393 11:77182581-77182603 CACCTCGCCCTCGCCCTGCAGGG - Exonic
1089060806 11:115624585-115624607 CACCATGCCCTGCAACTCCCAGG + Intergenic
1089124350 11:116165963-116165985 CACCTGGCCTTCCCACTGCTTGG - Intergenic
1089227155 11:116934789-116934811 CACCGCGCCCGGCCTATGCCTGG - Intronic
1089260648 11:117221758-117221780 CAGCTCGCCCTGCCCAGGCCAGG - Intronic
1089494943 11:118903137-118903159 CACCCCACCCTGCCCCTGCACGG + Intronic
1089571678 11:119415527-119415549 CACCTGGCCACGCCACTGCCAGG + Intergenic
1089685293 11:120142834-120142856 CACCTCAGCCTCCCAGTGCCTGG + Intronic
1091750673 12:3019629-3019651 CACCCCGCCCTCTCACTGACAGG + Intronic
1091765852 12:3119574-3119596 CAGCCCGTCCTGCCCCTGCCCGG + Intronic
1092185997 12:6478672-6478694 CACTTCCCCCTGCCGCTGCCTGG - Intergenic
1092221222 12:6715327-6715349 CACCTCGTCCTCCCAGTGCTGGG + Intergenic
1092298514 12:7222508-7222530 CACCACGCCCGGCCACAGGCAGG + Intergenic
1092783301 12:12006948-12006970 CACCGCGCCCTGCCCAGGCCCGG + Intergenic
1094351834 12:29535099-29535121 CCCCTCCCCCTGCCTCTGACAGG - Intronic
1094618411 12:32057178-32057200 CACCGCGCCCGGCCAATCCCAGG + Intergenic
1095438288 12:42215632-42215654 CACCATGCCCTGCCACTGTATGG - Intronic
1095962685 12:47845222-47845244 CACCTGGCCCTGTCCCTGCCTGG + Intronic
1096103916 12:48985777-48985799 CACCCCACCCTGCCCCTCCCAGG - Intergenic
1096401538 12:51311296-51311318 CACCTCGGCCTCCCACTGGGAGG + Intronic
1097017626 12:55998536-55998558 CCCCTCCCCCTGCCCCTGACAGG - Intronic
1097243163 12:57590271-57590293 CACCACGCCCGGCTAATGCCCGG + Intergenic
1098164497 12:67679649-67679671 CCCCACGCCCGGCCGCTGCCAGG + Intergenic
1098223620 12:68297930-68297952 CACCTAACCCAGCCCCTGCCTGG + Intronic
1099357575 12:81658018-81658040 CGCCTCGGCCTCCCACTCCCTGG - Intronic
1100294133 12:93245202-93245224 CACCACGCCCGGCCGCTACCAGG - Intergenic
1100831545 12:98520591-98520613 CACCTCACCCGGCCAATACCAGG + Intronic
1102036558 12:109773648-109773670 CCCCTCCCCCTGCCACTCGCTGG - Intergenic
1102079560 12:110086865-110086887 CACCACGCCCTGCCTCCACCTGG - Intergenic
1102110447 12:110361539-110361561 CACCTCAGCCTGCCAGTGCTGGG - Intergenic
1102167219 12:110816203-110816225 GACCTCTCCCTGACTCTGCCTGG + Intergenic
1102210510 12:111123470-111123492 CACCACGCCCAGCCATTACCAGG + Intronic
1102240964 12:111324436-111324458 CACCACGCCCTGCCTCTTCCTGG - Intronic
1102333012 12:112051457-112051479 CACCTCGGCCTCCCAGTGCTTGG + Intronic
1103293246 12:119864582-119864604 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1103601454 12:122057214-122057236 CACCTTGGTCTGCCCCTGCCTGG - Intronic
1104602289 12:130162141-130162163 CTCCTCGCCCTCTCTCTGCCTGG - Intergenic
1104694353 12:130852183-130852205 CACCGCGCCCGGCCGCTGTCAGG - Intergenic
1104986506 12:132600551-132600573 CCCCTCTCCCGGCCGCTGCCTGG - Intergenic
1104997658 12:132668636-132668658 GAACTCGCCCCTCCACTGCCAGG + Exonic
1105462620 13:20606467-20606489 CACTCCACCTTGCCACTGCCAGG - Intronic
1105792940 13:23820670-23820692 CACCTGGCTCTGCCTCTCCCAGG + Intronic
1106499038 13:30309426-30309448 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1107851843 13:44578117-44578139 CCCCTCGCCCTTCCACGGGCAGG + Intergenic
1111002529 13:82204974-82204996 CACCTGGATCAGCCACTGCCAGG + Intergenic
1111825625 13:93263651-93263673 CACCACGCCCCGCCACTGCCTGG + Intronic
1112372379 13:98805033-98805055 CACCCCGCCCTGCCTCTTCCCGG + Exonic
1112544256 13:100349549-100349571 CACCACGCCCGGCCACTTTCTGG + Intronic
1112810035 13:103207381-103207403 CACCGCGCCCGGCCCATGCCAGG + Intergenic
1113043054 13:106125343-106125365 CACCTCACCCTGCCAAGGCCAGG + Intergenic
1113800754 13:113085258-113085280 CATCGCGCCCTGCCCCTCCCAGG + Intronic
1114073198 14:19131770-19131792 CACCTCCCCCTGCCACAGAGGGG - Intergenic
1114089068 14:19268213-19268235 CACCTCCCCCTGCCACAGAGGGG + Intergenic
1115505772 14:34092912-34092934 CACCGCGCCTGGCCAGTGCCAGG + Intronic
1117395022 14:55300302-55300324 CACCTCGCCCGGCCACAACGTGG - Intronic
1117850673 14:59965633-59965655 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1119809165 14:77501680-77501702 CACCTCGGCCTCCCAAAGCCTGG + Intergenic
1119883269 14:78118949-78118971 CACCACACCCAGCCAATGCCTGG - Intergenic
1120383998 14:83820520-83820542 CACCGTGCCCTGCCAAAGCCAGG + Intergenic
1121010626 14:90518111-90518133 CCCCTCCCTCTGCCAGTGCCTGG + Intergenic
1121300976 14:92870722-92870744 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301175 14:92872503-92872525 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301309 14:92873653-92873675 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121311110 14:92935569-92935591 CACCTGGCGCTGCCTCTGCATGG - Intergenic
1121671042 14:95710927-95710949 CACCACCCCTCGCCACTGCCTGG - Intronic
1122323294 14:100868039-100868061 CAGCTCCCCCAGCCACTGCATGG + Intergenic
1122546300 14:102524600-102524622 AGCCTCGCCCTGCGGCTGCCTGG + Intergenic
1122647912 14:103207327-103207349 CTCCCCTCCCTGCCCCTGCCCGG + Intergenic
1122771267 14:104098985-104099007 CACCTGGCCCTGCTCCTGCGGGG - Intronic
1122880637 14:104689226-104689248 CACCTCTCTCTGCCCCGGCCCGG - Intergenic
1123035846 14:105471632-105471654 CACCTAGTCCTGTCACTGCTGGG - Intergenic
1123644355 15:22428294-22428316 CAGCTCCCCCTGCCACGCCCTGG + Intergenic
1124193557 15:27600835-27600857 CAGCTAGCCCCGCCCCTGCCAGG - Intergenic
1124573799 15:30889933-30889955 CACCGCGCCCAGCCAGTGCTTGG + Intergenic
1125064721 15:35468777-35468799 CACCGCGCCCAGCCTCTGCCTGG - Intronic
1125669145 15:41457283-41457305 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1126170050 15:45687877-45687899 CACCTGGTCCTGCCTCAGCCAGG + Intronic
1126354344 15:47779491-47779513 CACCGTGCTCTGCCATTGCCTGG - Intergenic
1126506173 15:49406678-49406700 CACCCTGCCCTGCCACTGCTGGG - Intronic
1126654771 15:50965365-50965387 CACCCAATCCTGCCACTGCCAGG - Intronic
1127201336 15:56655453-56655475 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1127869992 15:63064035-63064057 CACCTCTGCCTTCCACTTCCTGG + Intronic
1128044641 15:64606853-64606875 CACCACGCCCAGCCCATGCCTGG - Intronic
1128647306 15:69387146-69387168 CACATCACCCTCCCACTGTCAGG + Intronic
1129194821 15:73957514-73957536 CACCTCCCCAGGGCACTGCCAGG + Intergenic
1129794484 15:78365806-78365828 CTCCTGGCTCTGCCACTGACCGG + Intergenic
1130028881 15:80294313-80294335 CACCACGCCCGGCCCCTGACAGG + Intergenic
1130191230 15:81738066-81738088 CACCGCGCCCGGCCACAGTCAGG + Intergenic
1130539371 15:84811189-84811211 AGCCTCTCCCTGCCACTGCAGGG - Intergenic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1130695610 15:86128363-86128385 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1131116229 15:89797759-89797781 CACCCAGCCCAGCCACAGCCTGG + Intronic
1131174423 15:90201234-90201256 CCCCTCGCGCTGCCAGCGCCCGG + Intronic
1131482506 15:92794135-92794157 CACCACGCCCGGCCTCTGCCTGG - Intronic
1132227220 15:100151698-100151720 CCCCTAGCCCCGTCACTGCCAGG + Intronic
1132227226 15:100151706-100151728 CACCTGGCCCTGGCAGTGACGGG - Intronic
1132283580 15:100642557-100642579 CTCCAAGCCCTCCCACTGCCTGG + Intronic
1132545942 16:533510-533532 CACCTTTCCCTGGCAGTGCCTGG + Intronic
1132630072 16:913025-913047 CAGCACACGCTGCCACTGCCGGG + Intronic
1132691048 16:1182108-1182130 CTCCTGCCCCTGCCACAGCCCGG - Intronic
1132693032 16:1190123-1190145 CACCTCACTGCGCCACTGCCCGG + Intronic
1132745372 16:1434088-1434110 CACCTAGGCCTGCCCCCGCCAGG - Intergenic
1132915662 16:2341862-2341884 CACCTCTCCCTGCCACGCCAAGG - Intergenic
1132941653 16:2511520-2511542 CCCCTGCCCCTGCCGCTGCCTGG - Intronic
1133273899 16:4625245-4625267 TACCTGGCGCTGCTACTGCCCGG + Intronic
1133952217 16:10405409-10405431 CACCTTGCTCTGCCCCTTCCAGG - Intronic
1133970710 16:10566025-10566047 CACCACCCCCAGCCTCTGCCTGG + Intronic
1134475336 16:14568619-14568641 CACCGTGCCCTGCCAGCGCCCGG - Intronic
1134598030 16:15511332-15511354 CACCTGGCCGAGCCTCTGCCAGG - Intronic
1136245810 16:28975166-28975188 CACCGCGCCCTTCCTCAGCCAGG + Exonic
1136477141 16:30520485-30520507 CGCCTCGTCCTGGCTCTGCCAGG - Intronic
1136488136 16:30586181-30586203 CCCCTCGGGCTGGCACTGCCAGG - Intergenic
1136683402 16:31980855-31980877 CATCTCCCCCAGCCACAGCCCGG - Intergenic
1136784033 16:32924411-32924433 CATCTCCCCCAGCCACAGCCCGG - Intergenic
1136885749 16:33929395-33929417 CATCTCCCCCAGCCACAGCCCGG + Intergenic
1138146206 16:54614424-54614446 CACTTCCCCCTGCCACTGTCAGG + Intergenic
1139594857 16:67951579-67951601 CACCAGCCCCTGACACTGCCTGG - Intronic
1139754098 16:69129140-69129162 CACCGCACCCGGCCTCTGCCTGG - Intronic
1140445693 16:75025867-75025889 CACCCCGTCCCCCCACTGCCTGG - Intronic
1140969329 16:79997804-79997826 CACGTAGCCTTTCCACTGCCTGG + Intergenic
1141280578 16:82627193-82627215 CCCCTCACCCTGCCCGTGCCGGG - Intronic
1142057025 16:88004434-88004456 CACCTTTCCCTGCCACTGTGCGG + Intronic
1142127563 16:88417755-88417777 CACCTCCACCTCCCAGTGCCGGG + Intergenic
1142301332 16:89260152-89260174 CGCCTCGGCCTGCCACTGTTGGG - Intergenic
1142412198 16:89922620-89922642 CACCTGGACGTGCCACTGCCCGG - Intronic
1203086688 16_KI270728v1_random:1188413-1188435 CATCTCCCCCAGCCACAGCCCGG - Intergenic
1142540324 17:653905-653927 CACCTCGGCCTCCCACAGCGCGG - Intronic
1142670469 17:1485551-1485573 CTCCTCCCCCTGCAACTTCCCGG + Intronic
1142983261 17:3683480-3683502 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1143364067 17:6394251-6394273 CACCACTGCCTGCCCCTGCCAGG - Intronic
1143471483 17:7178463-7178485 CACCTTGCCCTGCCTCTGCAAGG - Intronic
1143889885 17:10094754-10094776 CACCGCGCCCGGCCACTCTCTGG + Intronic
1143904376 17:10197875-10197897 CACCGGCCCCTGCCACTGCCGGG + Intronic
1144728246 17:17512439-17512461 CACCTGGCCCTGCACCTCCCTGG + Intronic
1144832778 17:18140765-18140787 GTCCTCTTCCTGCCACTGCCAGG + Exonic
1145089706 17:19976803-19976825 CACCGCGCCCGGCCTCTGTCTGG + Intronic
1146320833 17:31845119-31845141 CACCGCGCCCAGCCAAGGCCTGG + Intergenic
1147028575 17:37610381-37610403 CACCTCGGCCTCCAAGTGCCAGG + Exonic
1147653958 17:42077987-42078009 CACCACCTCCTGCCACTGCTGGG + Intergenic
1147704864 17:42419597-42419619 CACCTAGCCCGGCCTCTGCATGG + Intronic
1148157992 17:45434224-45434246 CACCACTGCCAGCCACTGCCTGG - Intronic
1148443824 17:47725862-47725884 CTCCTCACCCTCCCACTGCTTGG + Intergenic
1148582411 17:48752904-48752926 CTCCTCGCCCTGGCAGAGCCGGG + Intergenic
1148611065 17:48964849-48964871 CACCACGCCCTGCCAACGCCTGG - Intronic
1148821098 17:50360180-50360202 CCCCTCTCCCTGCCCCTCCCTGG + Exonic
1149122668 17:53189123-53189145 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1149459144 17:56813116-56813138 CAGCTCCCCCAGCCCCTGCCGGG + Intronic
1149475098 17:56954269-56954291 CACCGCGCCCGGCCAATGCATGG - Intronic
1149533867 17:57417039-57417061 CACCTCGCAGTGACACTGGCAGG - Intronic
1150824825 17:68465218-68465240 CACCGCGCCCGGCCCCGGCCGGG + Intergenic
1151266915 17:72963456-72963478 CACCGCGCCCGGCCACTGTGGGG + Intronic
1151310267 17:73288505-73288527 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1151326955 17:73385509-73385531 CACCTGGCCCTGCCACTCACTGG + Intronic
1151598293 17:75091096-75091118 CACCTAGCCCTGGCACTCCCAGG - Intronic
1151818506 17:76483971-76483993 CACCGCGCCCGGCCACAGCTGGG - Intronic
1151891445 17:76953058-76953080 CACCTCGGCCTCCCAGTGCTAGG + Intergenic
1152205340 17:78971647-78971669 CACCTCCTCCTTCCCCTGCCCGG - Exonic
1152356370 17:79809666-79809688 CACCTCTCCCTTCCACCACCTGG + Intergenic
1153820084 18:8825230-8825252 CACCTCCCCCAGGCACTCCCGGG + Exonic
1155065557 18:22266085-22266107 CACCTCAACCTGCCAAAGCCTGG - Intergenic
1155297694 18:24400371-24400393 CCCCTGGCCCTGCCATTCCCGGG + Intergenic
1158198753 18:54916811-54916833 CACCTGGCCCTGCCCTTGACAGG - Intronic
1158424952 18:57330552-57330574 CACCGCGCCCAGCCAGTGCATGG + Intergenic
1160010883 18:75106421-75106443 CCCCTCACCCTGCCTCAGCCAGG - Intergenic
1160684125 19:425529-425551 CACCCCGCCCTGGCCCTCCCCGG + Intronic
1160699130 19:497727-497749 GACCCCGCCCCGCCTCTGCCCGG - Intronic
1160709281 19:543594-543616 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1160770883 19:830566-830588 CACCGCACCCGGCCCCTGCCGGG + Intronic
1160922890 19:1528955-1528977 CACCTCGCCGTCCCACTCCATGG - Exonic
1160951699 19:1670708-1670730 CACCGCGCCCGGCCCATGCCCGG + Intergenic
1161129770 19:2581051-2581073 CACTGCGCCCGGCCTCTGCCTGG + Intronic
1161170153 19:2808457-2808479 CCCCTGCCCCTGCCCCTGCCCGG - Intronic
1161487348 19:4543416-4543438 CAGCTCGCCCTCCCCCTACCCGG - Exonic
1162158445 19:8695630-8695652 CACCCCACCCTGTCCCTGCCAGG - Intergenic
1162736334 19:12748952-12748974 CTCCTCCCTCTGCCACTGCCTGG + Intergenic
1162817321 19:13203954-13203976 CACCGCGCCCGGCCAATGCCTGG + Intergenic
1163054263 19:14706452-14706474 CACCTTCCCCAGCCCCTGCCTGG + Intronic
1163114970 19:15183685-15183707 CACCTCGCCCGGCCTCTGGGGGG + Intronic
1163241178 19:16064777-16064799 CACCCCGCTCTGCCACAACCAGG - Intergenic
1163355206 19:16806159-16806181 CACCACGCCCTGCCATTAACAGG + Intronic
1163407219 19:17130326-17130348 CACCGTGCCCGGCCAATGCCCGG - Intronic
1163410412 19:17150482-17150504 CCCCTGGCCCTGCCACTCCTTGG + Intronic
1163444066 19:17336672-17336694 GACCCCGCCCAGCCAGTGCCTGG + Intronic
1163534065 19:17866917-17866939 CACCACGCCCAGCCTCTGCATGG - Intergenic
1163679065 19:18670140-18670162 CTCCGCGCCCTGCCACTCCCTGG + Exonic
1163691595 19:18741584-18741606 CCCCTCCCTCTGCCACAGCCCGG + Intronic
1164557288 19:29263416-29263438 CCCCTCCCCCTGACACTGCCTGG + Intergenic
1164575516 19:29403312-29403334 CACCTGTGCCTGCCACTGCCTGG - Intergenic
1164633624 19:29777451-29777473 AACCTGACTCTGCCACTGCCTGG + Intergenic
1165065813 19:33227067-33227089 CTCCAGGCCCTGCCGCTGCCAGG - Intergenic
1165457405 19:35921045-35921067 CACCTCGCCCTGCCAATAGGTGG + Intergenic
1165555974 19:36632479-36632501 CACCGTGCCCAGCCACTGCATGG + Intergenic
1165722808 19:38091607-38091629 CACCCTGCCCTGCCACTCCCTGG - Intronic
1165852403 19:38857299-38857321 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1165856001 19:38879582-38879604 CACCTCACCCTGTCCCTTCCAGG + Intronic
1166704878 19:44903219-44903241 CACCTCCCCCTGCCACAGAGGGG + Exonic
1166857104 19:45787777-45787799 CACCACGCCCAGCCACTTCTGGG - Intronic
1167053437 19:47094353-47094375 CCCCTGGGACTGCCACTGCCTGG - Intronic
1167121533 19:47520257-47520279 CCCCTGCCCCTGCCCCTGCCAGG + Intergenic
1167135526 19:47613152-47613174 CCCCTGGCCCTTCCACAGCCTGG - Intronic
1167503497 19:49859964-49859986 CACCACGCCCTGTGCCTGCCAGG + Exonic
924986801 2:278602-278624 CTCCTCCCCATGGCACTGCCTGG - Intergenic
925399041 2:3558568-3558590 CATCTCGACCTTCCTCTGCCGGG - Exonic
926126921 2:10277646-10277668 CTCCTCCCTCTGCCTCTGCCTGG - Intergenic
926699709 2:15795635-15795657 CACCTGGCCTGGCCACAGCCAGG + Intergenic
927638246 2:24831452-24831474 CACCACAGCCTGCCACAGCCTGG + Intronic
928155006 2:28868762-28868784 CACCTCGGCCTCCCAGTGCTGGG - Intronic
929195565 2:39180935-39180957 CACCTCGGCCTCCCAGTGCTGGG + Intronic
929777758 2:44939224-44939246 GGCCTCTCCCTGCCACTGCCCGG - Intergenic
930075141 2:47400437-47400459 CACCCCGCCCAGCCTCAGCCTGG - Intergenic
930434926 2:51328717-51328739 CAGCTTGCACTGCCATTGCCAGG - Intergenic
930691586 2:54371091-54371113 CATCGGGCCCTGCAACTGCCTGG - Intronic
931857360 2:66317378-66317400 CGCAGCGTCCTGCCACTGCCTGG - Intergenic
932026929 2:68143257-68143279 CACTTCAACCTCCCACTGCCAGG + Intronic
932414967 2:71568102-71568124 CACCTCTGCCTCCCACTACCTGG + Intronic
933463427 2:82619464-82619486 TTTCTGGCCCTGCCACTGCCAGG + Intergenic
934649590 2:96083376-96083398 CCCCTCCTCCTGACACTGCCAGG - Intergenic
934766275 2:96881869-96881891 AACCTAAACCTGCCACTGCCTGG + Intronic
934783362 2:96986882-96986904 CACCGCGCCCTGCCCACGCCAGG - Intronic
935028110 2:99296627-99296649 CACCAAGCCCTGCCACTCCAGGG + Intronic
935911063 2:107896526-107896548 CACCGCGCCCAGCCCATGCCTGG + Intergenic
935997906 2:108793888-108793910 CACCGCGCCCTGCCACCCTCAGG + Intronic
936280504 2:111135925-111135947 CACCTCTGCCTGCTTCTGCCAGG + Intronic
936547369 2:113404267-113404289 CACCGCGCCCGGCCATTCCCAGG - Intergenic
937084220 2:119159846-119159868 CTCCAAGCCCGGCCACTGCCAGG + Intergenic
937225906 2:120368553-120368575 CCCCTCACCCAGCCACTGCCTGG - Intergenic
937908139 2:127062280-127062302 CACCACCCCCAGCCCCTGCCAGG + Intronic
937944110 2:127315794-127315816 CACCACGCCCAGCCGATGCCTGG - Intronic
938398226 2:130965953-130965975 AACCCTGCCCTGCCATTGCCGGG - Intronic
939044242 2:137231216-137231238 CACCTTCCCCAGCCAGTGCCAGG - Exonic
940586731 2:155661466-155661488 CACCTCGCCCGGCCAAGACCTGG - Intergenic
940899798 2:159116136-159116158 CACCGCGCCCAGCCACTAACAGG - Intronic
940918101 2:159280401-159280423 CACCGCGCCCGGCCACTTCTGGG - Intronic
943759551 2:191593199-191593221 CACCGCGCCCGGCCACCCCCTGG - Intergenic
946248303 2:218399308-218399330 CACCTCGCCCTGGGGCTGCGGGG + Intronic
946862552 2:224014084-224014106 CACCTCGCATGGCCACTCCCTGG - Intronic
947290046 2:228562903-228562925 CACCTCGGCCTCCCAATGACTGG - Intergenic
947417864 2:229917090-229917112 CACCGCGCCCGGCCAGTGCTTGG - Intronic
947760875 2:232602984-232603006 CACCGTGCCCTACCACTGGCTGG + Intergenic
947910816 2:233799616-233799638 CACCTCCCCCTGCCTCATCCAGG - Intronic
948692940 2:239718442-239718464 CTCCTGGCCCTGCCACTGCCTGG + Intergenic
1169484066 20:6011832-6011854 CACCTCGGCCTCCCTCGGCCTGG + Intronic
1170848804 20:19985000-19985022 CCCCTCTCACTGCCACTGTCTGG - Intronic
1171753778 20:29080718-29080740 CATCTCTCCCGGCCTCTGCCTGG + Intergenic
1171788468 20:29496812-29496834 CATCTCTCCCGGCCTCTGCCTGG - Intergenic
1172116239 20:32575042-32575064 CACCTCACTATGCCTCTGCCTGG + Intronic
1172483128 20:35283481-35283503 CATCTCTCCCTGCCACTGACTGG - Intronic
1172809550 20:37637445-37637467 CCACACGCCCTGCCTCTGCCTGG + Intergenic
1173210758 20:41029508-41029530 CCCCGCGCCCTGCCGGTGCCGGG + Intronic
1173980173 20:47217911-47217933 CTCCTCTCCCTTCCACTCCCTGG + Intronic
1174369563 20:50077490-50077512 CACCGCACCCGGCCCCTGCCTGG - Intergenic
1174383159 20:50170620-50170642 CACCTCGGCCTCCCAGTGGCGGG + Intergenic
1174402649 20:50284177-50284199 CTCCTCACACTGCCACTTCCGGG + Intergenic
1174575569 20:51534581-51534603 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1174615836 20:51834743-51834765 CACCGCGCCCTGCCTATGCCAGG - Intergenic
1174795337 20:53517654-53517676 CACCTCTCCCCGCCACCCCCGGG + Intergenic
1174796487 20:53526917-53526939 CACCTCCCCCTCCCACCCCCTGG - Intergenic
1175171609 20:57085054-57085076 CACCCCGCCCTGTGACTGTCAGG - Intergenic
1175174899 20:57105471-57105493 CACCCCGACTTCCCACTGCCCGG + Intergenic
1175613704 20:60374108-60374130 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1176146964 20:63569760-63569782 GTCCTGGCCCTGCCACTTCCTGG + Intronic
1176371742 21:6066509-6066531 CAGCTCTCCCTTCCTCTGCCTGG + Intergenic
1176423467 21:6533622-6533644 CACCCTGCCCTGACACCGCCCGG - Intergenic
1177728463 21:24997163-24997185 CACCGCGCCCCGCCAATGACAGG - Intergenic
1178352720 21:31884341-31884363 CACCTCGCCCTCCCAAAGTCTGG - Intronic
1179511275 21:41875315-41875337 CCCCTCGCCCTGCCAGGCCCCGG + Intronic
1179612428 21:42560912-42560934 AGCCTCCCCCTGCCACCGCCAGG + Intronic
1179698961 21:43141938-43141960 CACCCTGCCCTGACACCGCCCGG - Intergenic
1179751777 21:43472030-43472052 CAGCTCTCCCTTCCTCTGCCTGG - Intergenic
1179782974 21:43714345-43714367 CACCGCGCCCGGCCAGTCCCAGG + Intergenic
1180259566 21:46659656-46659678 CACACCTCCCTGCCACTGCCAGG - Intronic
1180491639 22:15854123-15854145 CACCTCCCCCTGCCACAGAGGGG - Intergenic
1180920839 22:19520814-19520836 CACCTGCACCGGCCACTGCCTGG + Intergenic
1181026970 22:20132148-20132170 CGCCCCGCCCGCCCACTGCCCGG - Intronic
1181266821 22:21635405-21635427 CACCTCACCCTGCCCACGCCAGG + Intronic
1182116587 22:27760059-27760081 CACCACGCCCAGCCAATGTCTGG - Intronic
1182714030 22:32340862-32340884 AAGATCGCCCTGCCACTGTCGGG + Intergenic
1183509933 22:38228766-38228788 TATCTCTCCCTGCCACCGCCAGG + Intronic
1183626144 22:39003436-39003458 CACCTGGGCCTGCAGCTGCCAGG + Intergenic
1183703863 22:39465041-39465063 CACCACGCCCGGCCTCTGTCAGG + Intronic
1183855302 22:40629153-40629175 CACCGCGCCCAGCCTCTGCTTGG - Intronic
1184073109 22:42158882-42158904 CACCACGCCCTGCCAGATCCAGG + Intergenic
1184204914 22:42995930-42995952 CACCACGCCCAGCCAATACCTGG - Intronic
1184242104 22:43216772-43216794 AACCTGGCCCTTCCCCTGCCAGG + Intronic
1184331972 22:43833148-43833170 CCCCAAGCCCTGCCTCTGCCTGG + Intronic
1184661876 22:45969204-45969226 CCCCCCACCCTGCCACAGCCAGG + Intronic
1184943185 22:47783424-47783446 CACCACGCCCGGCCTCTCCCAGG + Intergenic
1185232868 22:49693424-49693446 GGCCTCGCCCTGTCACTGCCTGG - Intergenic
949849813 3:8411542-8411564 CCCCGCTCCCTACCACTGCCAGG + Intergenic
949865877 3:8546734-8546756 CACCTCCCCCTGCCCCTGGAAGG - Intronic
950362895 3:12462375-12462397 CTCCTCTCCCTGCCACCACCGGG + Intergenic
950861149 3:16148642-16148664 CACCTCACCCTTCCCCTTCCAGG + Intergenic
951064640 3:18249605-18249627 ATCCTAGCCCTGCCACTTCCTGG - Intronic
954058051 3:48044512-48044534 CACCTCGGCCTCCCAGTGCTGGG - Intronic
954410516 3:50368647-50368669 GACCTCACCCTGCCTCTTCCTGG + Intronic
954438559 3:50509062-50509084 CCTCTCTCCCTGCCTCTGCCAGG - Intergenic
954462978 3:50638229-50638251 CTCCTCCCCCTCCCCCTGCCTGG - Intronic
954628160 3:52034224-52034246 CACCGCGCCCGGCCAATGCCTGG + Intergenic
954675455 3:52313073-52313095 CACCACGCCTCGCCAGTGCCAGG + Intergenic
955025679 3:55165146-55165168 CACCTGGCCCTTCCTCAGCCTGG - Intergenic
955055165 3:55448143-55448165 CACCGCGCCCAGCCTCTTCCTGG - Intergenic
958785722 3:98594184-98594206 CACCGCGCCCGGCCCCAGCCTGG - Intergenic
960282289 3:115792701-115792723 CTGCTCACCCTGCCCCTGCCTGG - Intergenic
961435001 3:126910907-126910929 CACCTCGCCCTGACAAGGACGGG + Intronic
961735798 3:129001565-129001587 CCCTTCGCCCCGCCACTTCCAGG - Intronic
961833167 3:129635082-129635104 CACCGTGCCCAGCCAATGCCTGG + Intergenic
961884742 3:130089169-130089191 CAGCTTGCCCTCCTACTGCCTGG - Intronic
962106414 3:132395280-132395302 CACCACTCCCTACCACTGCCAGG - Intergenic
962367177 3:134794383-134794405 CACCTCGCCTTGCACCGGCCTGG + Intronic
962594079 3:136922069-136922091 CACCGCGCCCGGCCACTGAGTGG + Intronic
963604094 3:147399285-147399307 GACCTGGCCATGCCACTGCTTGG - Intronic
966842818 3:184103339-184103361 CACCGCGCCCGGCCACCACCCGG - Intronic
967884339 3:194322906-194322928 CACCTTGCCCTGCCCCACCCAGG - Intergenic
967962685 3:194938716-194938738 CTCTTTTCCCTGCCACTGCCAGG - Intergenic
968236094 3:197030542-197030564 CAGCTGGCTCTGCCACTGACTGG - Intergenic
968298637 3:197596517-197596539 CCCCTGCCCCTGCCCCTGCCAGG - Intergenic
968610028 4:1552688-1552710 CACCTGGCCCGGCCACTACAAGG + Intergenic
968823838 4:2878078-2878100 AACCTCACTCTGCCACTCCCAGG - Intronic
969152635 4:5183187-5183209 CACCATGCCCGGCCAATGCCTGG - Intronic
969624843 4:8297182-8297204 CTCCTGGCCCTGCTCCTGCCAGG - Intronic
972582103 4:40404096-40404118 CACCACGCCCAGCCAAAGCCAGG + Intergenic
972629502 4:40831147-40831169 CACCTCGGCCTCCCAGTGCTGGG - Intronic
975203107 4:71614865-71614887 CACCTATCCCTGCCCCTACCTGG + Intergenic
975942833 4:79668408-79668430 CACCTATCCCTGCCCCTACCTGG + Intergenic
976423593 4:84874123-84874145 CACCTCGCCCGGTCTCTGCTTGG - Intronic
977594831 4:98867118-98867140 CACCGCGCCCGGCCAATTCCAGG - Intergenic
977788962 4:101075130-101075152 CACCTGGCCCTGCCCTTGACAGG + Intronic
977799357 4:101207576-101207598 CACCTCGGCCTCCCAGTGCTGGG - Intronic
978141339 4:105320686-105320708 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
978738019 4:112106520-112106542 CACCTCGGCCTGCCAAGTCCTGG + Intergenic
979349462 4:119628064-119628086 CCCCTCGCCCTGGCCCTGGCTGG - Intronic
980040566 4:127934843-127934865 CACCACGCCCAGCCTATGCCAGG + Intronic
980941469 4:139279410-139279432 CACGTCGTCCTGCAACTGCTTGG - Intronic
981454442 4:144937383-144937405 CACCGCGCCTAGCCACTTCCAGG - Intergenic
982033715 4:151325533-151325555 GCCCGCGCCCTGCCGCTGCCCGG - Intronic
982846460 4:160259183-160259205 CACCTCGGCCTCCCAATGCTGGG + Intergenic
983944388 4:173569269-173569291 CACGGCGCCCAGCCACTGCCTGG + Intergenic
985534903 5:458914-458936 CCCCTTGCCCTTCCTCTGCCTGG + Intronic
985787757 5:1908489-1908511 CACCTCACTTTCCCACTGCCTGG - Intergenic
985796632 5:1966844-1966866 CACTTCGCCCTGCCTTTCCCTGG - Intergenic
986259018 5:6126288-6126310 CACCTATCCCTGCCCCTACCTGG + Intergenic
987291231 5:16510386-16510408 CACATTGCCCTGCCTCTGACAGG - Intronic
988693681 5:33597557-33597579 CACCTCGCACTGCCTCAGCATGG + Intronic
992893495 5:81226461-81226483 CACCTCAGCCAGCCACTGTCTGG - Exonic
995191472 5:109322906-109322928 ACCCTCTCCCTCCCACTGCCTGG + Intergenic
995494075 5:112723187-112723209 CACCACGCCCAGCCAGTTCCTGG - Intronic
996793680 5:127320596-127320618 CACCTCCCACTTCCACTTCCTGG - Intronic
998094964 5:139391779-139391801 CACCACGCCCTGGGAATGCCTGG + Exonic
998383281 5:141741231-141741253 CAACTCACCCTCCCACTCCCAGG - Intergenic
998472510 5:142394183-142394205 CACCTCCCCCTCCCCCTCCCAGG + Intergenic
998854245 5:146379114-146379136 CTCCTGGCCTTGCCACCGCCTGG + Intergenic
999165916 5:149549679-149549701 CAACTCGAACTGACACTGCCGGG + Intronic
999439899 5:151593098-151593120 CCCCTCACCCTGCAACTCCCTGG - Intergenic
999516161 5:152303837-152303859 CATGTCTACCTGCCACTGCCTGG + Intergenic
999734270 5:154500962-154500984 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1002000679 5:176194855-176194877 CCCCTGCCCCTGCCCCTGCCTGG - Intergenic
1002027853 5:176407550-176407572 CACCTCAGCCTCCCACTGCTGGG + Intronic
1002253660 5:177944126-177944148 CCCCTGCCCCTGCCCCTGCCTGG + Intergenic
1002443187 5:179274808-179274830 CACCTCCACCAGCCCCTGCCTGG - Intronic
1002450356 5:179315075-179315097 CTCCTCCCCCTGCCCCTGCATGG + Intronic
1002454773 5:179339714-179339736 CACCCCACCTTGGCACTGCCTGG - Intronic
1002525949 5:179816394-179816416 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1004232564 6:13846503-13846525 CACCTCGCCCGGCCAGTGTTTGG + Intergenic
1004352613 6:14903407-14903429 GTCCTCGCTCTGCCACTTCCTGG + Intergenic
1004355942 6:14930130-14930152 CACCGCGCCCAGCCAGTACCAGG + Intergenic
1006118802 6:31791779-31791801 CACCTCTCCCAGCCCCTCCCAGG + Intronic
1006563523 6:34934434-34934456 CACCACGCCCAGCCACCCCCAGG + Intronic
1006904399 6:37523256-37523278 CACCACCCCCGGCCTCTGCCCGG - Intergenic
1007178563 6:39912646-39912668 CACCCCTCTCTGCCACTTCCTGG + Intronic
1012094063 6:94935363-94935385 CACCACGCCTGGCCCCTGCCTGG - Intergenic
1012611644 6:101226862-101226884 CACCTGGCCCTCCCTCTGCCTGG + Intergenic
1014757076 6:125313178-125313200 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1015595853 6:134866091-134866113 CACCGCGCCCTGCCAGTTCTTGG - Intergenic
1015637083 6:135287806-135287828 CACCATGCCCGGCCACGGCCCGG - Intronic
1016053053 6:139550345-139550367 CACCGAGCCCTGCCGCTGTCTGG + Intergenic
1017697770 6:157035743-157035765 CACCAGGCTCTGCCAGTGCCAGG + Intronic
1017769663 6:157635279-157635301 TACCGCGCCCAGCCACTGCCTGG + Intronic
1017869919 6:158478638-158478660 CACCCCACCCTGCAACTGCCTGG + Intronic
1017985167 6:159437114-159437136 CAGGTGCCCCTGCCACTGCCCGG - Intergenic
1018703660 6:166447857-166447879 GACCTCGCTCTGCGACAGCCTGG + Intronic
1019501592 7:1367425-1367447 CCCCTAGCCCTGCCAAGGCCCGG + Intergenic
1019680903 7:2348662-2348684 CACCGCGCCTGGCCACTGGCTGG - Intronic
1019776267 7:2913610-2913632 CACCTCGGGCTGGCACTGCTTGG + Intronic
1019965319 7:4494096-4494118 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1020303879 7:6817762-6817784 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1020488069 7:8743970-8743992 CACCGCGCCCTGCCAAAGCATGG + Intronic
1022704829 7:32792514-32792536 CACCGCGCCCGGCCACCTCCAGG - Intergenic
1023370516 7:39508340-39508362 CACCTCCTCCTGTCAATGCCCGG + Intergenic
1023719405 7:43077573-43077595 CACCCCGCCCCGTCACTCCCGGG - Intergenic
1023890887 7:44391254-44391276 CACCTGGCCCTGCCACACCAGGG - Intronic
1024849329 7:53692083-53692105 CACCTCCCCCTGCCAGGGTCAGG - Intergenic
1025085859 7:56022768-56022790 CACCGCGCCCAGCCTCTTCCTGG - Intronic
1025927293 7:65970237-65970259 CACTTCTCCCTGCCTTTGCCTGG - Intronic
1026001743 7:66564783-66564805 CACCACGCCCAGCCTATGCCTGG + Intergenic
1026015414 7:66667542-66667564 CACCGAGCCCTGACACTGACAGG + Intronic
1026611770 7:71866293-71866315 CACCGCGCCCAGCCAATACCAGG + Intronic
1026878498 7:73893589-73893611 CACCTGGCCCTGGCCCAGCCTGG + Intergenic
1026884097 7:73927866-73927888 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1026891825 7:73986694-73986716 CACCGTGCCCTGACACTGACAGG + Intergenic
1026957372 7:74386326-74386348 CACCACGCCCGGCCAGTGTCAGG + Intronic
1027134945 7:75617503-75617525 CACCGCGCCCAGCCTCAGCCTGG + Intronic
1028268449 7:88758502-88758524 CACCTCGCCTTGTCTGTGCCTGG - Intergenic
1029296791 7:99546607-99546629 CACCTCGGTCTCCCACTGCTGGG + Exonic
1029504052 7:100951462-100951484 CTCCTCCCCCTGCTACTGCCTGG - Intronic
1029710070 7:102294678-102294700 CTCCTGCCCCTGCCACAGCCAGG + Intronic
1030027020 7:105334364-105334386 CACCACGCCCGGCCAATGCCTGG + Intronic
1030084594 7:105805726-105805748 CCCCTCCCCCTGCGACTGCCTGG - Intronic
1032622465 7:133550132-133550154 CACCTCTCCCTGCCAGTGTAGGG - Intronic
1033098835 7:138453624-138453646 CACCCCCCACTGCCACTCCCTGG + Intergenic
1033297843 7:140157402-140157424 CACCTCGGCCTCCCAAGGCCAGG - Intronic
1034307739 7:150059118-150059140 CACCTGGTTCTTCCACTGCCTGG + Intergenic
1034799109 7:154041551-154041573 CACCTGGTTCTTCCACTGCCTGG - Intronic
1036201418 8:6774102-6774124 CAGCTCTCACTGCCGCTGCCCGG - Intergenic
1036225574 8:6954831-6954853 CAGGTGGCCCTGCCAATGCCAGG - Intergenic
1036570763 8:9978016-9978038 CACCATGCCCTGCCAATGTCTGG + Intergenic
1036944613 8:13082914-13082936 CACCGCGCCCGGCCACTTCATGG - Intergenic
1037333470 8:17767951-17767973 TGCCTCGTGCTGCCACTGCCAGG - Intronic
1037622377 8:20576033-20576055 CACCGCGCCCGGCCCCTGCCAGG + Intergenic
1038326028 8:26573378-26573400 CACCGCGCCCGGCCACGCCCAGG - Intronic
1039572654 8:38600004-38600026 CACCTCACCCAGCCAATCCCAGG + Intergenic
1040313338 8:46248110-46248132 CACCTCTCCCGGCCAAAGCCAGG - Intergenic
1040423387 8:47260872-47260894 CACCGCGCCCTGCCATTGGCGGG - Exonic
1041924973 8:63227479-63227501 CACCGCGCCCGGCCACTTTCTGG - Intergenic
1041929634 8:63272695-63272717 GCCCTCGCCCACCCACTGCCTGG + Intergenic
1044609867 8:94080715-94080737 CCCCTCTGCCTGCCACTGGCCGG + Intergenic
1044677338 8:94742844-94742866 CACCGCGCCCGGCCAATGCCTGG + Intronic
1044743664 8:95352189-95352211 CACCTTCCTCTGCCACAGCCAGG - Intergenic
1045219382 8:100182532-100182554 CAGCTCTCCCTGCCCCTCCCAGG - Intronic
1045425330 8:102060438-102060460 TACCTCGCCCAGCCAGTGCCTGG - Intronic
1045532637 8:102999237-102999259 CACCGCGCCCAGCCACTGAAGGG + Intergenic
1049468873 8:142766477-142766499 CACCGCTCCCTGCAGCTGCCTGG - Intronic
1049592560 8:143469204-143469226 CACCTCCCTCTGCCAGGGCCTGG + Intronic
1049763085 8:144339567-144339589 CACCTCTCCCTGCCCCTCCCAGG + Intergenic
1049786546 8:144453716-144453738 CAGCTCGCCCTGGCAGTGACGGG + Intronic
1050534706 9:6621802-6621824 CACCGCGCCCTGCCACTGAAGGG + Intronic
1050828431 9:9980357-9980379 CACCTCGGCCTCCCAATTCCTGG - Intronic
1050894527 9:10870582-10870604 CACCACGCCCGGCCAAAGCCAGG - Intergenic
1052476733 9:28970531-28970553 CTCCACACCCTGCCACTGCTGGG - Intergenic
1053052858 9:34976378-34976400 CACCTATCCCTGTCACAGCCTGG + Intronic
1053509434 9:38675167-38675189 CACCTGGCTCTGTCTCTGCCAGG + Intergenic
1057076639 9:92141542-92141564 CCCGGCCCCCTGCCACTGCCAGG + Intergenic
1058426787 9:104882393-104882415 CCCCTTGCCAGGCCACTGCCTGG + Intronic
1058945380 9:109850887-109850909 CACCACGCCCGGCCACTACCAGG - Intronic
1059830309 9:118087780-118087802 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1060145326 9:121247891-121247913 CACCACACCCCGCCACTGCAAGG + Intronic
1060265382 9:122108929-122108951 CACCTGGCCCTGCCTCAGGCAGG + Intergenic
1060482802 9:124027528-124027550 CACCACACCCAGCCAGTGCCAGG - Intronic
1060630839 9:125157126-125157148 CCCCTCCCCCTACCAGTGCCCGG + Intronic
1060660892 9:125404749-125404771 CACCACACCCAGCCAATGCCTGG + Intergenic
1060741384 9:126099763-126099785 CTCCTGGCTCTGCCACTTCCTGG + Intergenic
1060792996 9:126498317-126498339 CACCTCTCCCTGCCTGTGCTAGG + Intronic
1060853677 9:126898154-126898176 CACCACGCCCAGCCTCTGCCTGG - Intergenic
1061395485 9:130341400-130341422 CAGCTCTCCCAGCCACAGCCTGG + Intronic
1061580029 9:131530947-131530969 TCCCGCGCCCTGCCCCTGCCTGG + Intronic
1061632285 9:131880042-131880064 GACCTCCCTGTGCCACTGCCAGG - Intronic
1061749683 9:132769212-132769234 CACCCTGCCCTGCCACTGCCTGG + Intronic
1061767993 9:132894550-132894572 GACCACGCCCTGCCACAGGCTGG + Exonic
1061948467 9:133921963-133921985 CCACTCGCCCTGCCGGTGCCGGG - Intronic
1062381793 9:136290372-136290394 GCCCTCGCCCGGCCACTCCCTGG + Intronic
1062442043 9:136574999-136575021 GGCCTCGCTCTGCCACTGCTCGG + Intergenic
1185629361 X:1504842-1504864 CACCACGCCTGGCCAATGCCCGG - Intronic
1185629660 X:1506962-1506984 CACCGCGCCCGGCCACTTTCTGG + Intronic
1185640061 X:1585097-1585119 CACCACGCCCGGCCCATGCCTGG - Intergenic
1185734118 X:2484636-2484658 GAACTCGCCATGCCCCTGCCTGG - Intronic
1187395048 X:18911965-18911987 CACTTCACTCTGCCACTGCTGGG + Intronic
1190055012 X:47176183-47176205 CACTCGGCCCTGACACTGCCAGG - Intronic
1190313543 X:49134449-49134471 CACCACGCCCAGCCTTTGCCAGG + Intergenic
1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG + Intronic
1192122770 X:68472826-68472848 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1192127412 X:68515036-68515058 CACCGCGCCCGGCCAAGGCCAGG - Intronic
1194227377 X:91278184-91278206 CACCGCGCCCAGCCACAGCAAGG - Intergenic
1195086568 X:101418746-101418768 CAGCTCCCCCTGCCCCGGCCAGG - Intronic
1196079496 X:111616211-111616233 CACCGCGCCCGGCCTGTGCCCGG + Intergenic
1199082337 X:143590966-143590988 CACCTTTCCCTGGCACTGGCTGG - Intergenic
1199966971 X:152828734-152828756 CCTGTAGCCCTGCCACTGCCTGG + Intronic
1200180703 X:154148915-154148937 CACTGCGCCCGGCCACAGCCTGG - Intronic
1200875192 Y:8147094-8147116 CACCATGCCCAGCCACTTCCTGG + Intergenic
1201053859 Y:9968418-9968440 CACCTTGCCCAGCCACTTCCTGG + Intergenic
1202102205 Y:21321742-21321764 CACCGCGCCCAGCCACTTCTTGG + Intergenic
1202187910 Y:22207289-22207311 CACCTCACCCAGCCACTTCCTGG + Intergenic
1202203450 Y:22379107-22379129 CACCTCACCCAGCCACTTCCTGG - Intronic
1202240230 Y:22759629-22759651 CACCATGCCCAGCCACTTCCTGG - Intergenic
1202393216 Y:24393383-24393405 CACCATGCCCAGCCACTTCCTGG - Intergenic
1202477569 Y:25276717-25276739 CACCATGCCCAGCCACTTCCTGG + Intergenic