ID: 1190962784

View in Genome Browser
Species Human (GRCh38)
Location X:55268819-55268841
Sequence CAAGACTCCTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 11, 3: 53, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190962784 Original CRISPR CAAGACTCCTTGGGAAAAAC AGG Intronic
900304121 1:1994874-1994896 CAAGGGTCATTGGGAGAAACAGG + Intronic
900843267 1:5074232-5074254 AAAGCCCCCTTTGGAAAAACTGG + Intergenic
901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG + Intronic
902130027 1:14252191-14252213 GAAGACTCCTTAGGAACATCTGG - Intergenic
903770500 1:25760777-25760799 CAAGACCCCTTGGGAGAGAAAGG - Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907700373 1:56780777-56780799 CACTGCTCCTTGTGAAAAACAGG + Intronic
909133023 1:71763389-71763411 CATGCCCCATTGGGAAAAACTGG + Intronic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909801907 1:79820523-79820545 CAAGAGTCCTGTGGAAAATCAGG - Intergenic
915605543 1:156947949-156947971 CAATGCTCCTGGGGGAAAACAGG + Exonic
916222287 1:162457054-162457076 TAAGACTTCTAGAGAAAAACAGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917306938 1:173636836-173636858 CAAGCCTCCTTAGAAAAACCTGG + Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917467073 1:175289210-175289232 CAAGACTCCTTGTGCAGAAAAGG - Intergenic
918774902 1:188614931-188614953 AAAAACTCAATGGGAAAAACAGG + Intergenic
920753138 1:208701268-208701290 CAAGACTCCATCTCAAAAACAGG + Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
924209226 1:241747782-241747804 AAAGACTTCCTGGGAAAGACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063164721 10:3450783-3450805 GAAGTCACCTTGGGAAGAACGGG + Intergenic
1064752956 10:18550662-18550684 CAAAACTCATTGATAAAAACAGG - Intronic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1067354172 10:45509670-45509692 AAAGCCTTCTTTGGAAAAACTGG + Intronic
1068028992 10:51684505-51684527 AAAGACACCATGGGAAAAATAGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071960346 10:90803918-90803940 CAACACTCGGTGGGAGAAACAGG - Intronic
1072554356 10:96503559-96503581 CAAGCCTCCTTGGGAAAGATTGG + Intronic
1072767824 10:98110069-98110091 CAACATTCCTTGAGAGAAACTGG + Intergenic
1074474163 10:113754482-113754504 CAAGACTCCTGAGGATAACCTGG - Intronic
1075235628 10:120725069-120725091 CAAGACAGCACGGGAAAAACTGG - Intergenic
1075762605 10:124868229-124868251 CAAGAATCCTTCAAAAAAACAGG + Intergenic
1076144624 10:128107645-128107667 CAAGACACCTTTGGAGAAAAGGG - Exonic
1076985452 11:232907-232929 CGAGCCTCCCTGGGAGAAACAGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080405438 11:31974669-31974691 AAAAAATCCTTGGGAAAATCAGG + Intronic
1080419008 11:32093776-32093798 CAAAACTCATTGGGAAAGTCAGG + Intronic
1080603196 11:33841175-33841197 CAAGTCTTCATGGGAAAAATAGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1082692549 11:56324079-56324101 CAAGACGACGTGGGAAAATCTGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083076228 11:60041872-60041894 CAAAACTCCGTCTGAAAAACAGG + Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1084941056 11:72613546-72613568 CAAGACTCCTGGAGAGGAACAGG - Intronic
1086546780 11:88005698-88005720 CAAAACTACTTGTAAAAAACAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1093033799 12:14314207-14314229 CAAGAATCCTAGGGAACACCTGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095193868 12:39289778-39289800 CAAGCCTCCTCAGGAAAGACAGG - Intergenic
1097023267 12:56035397-56035419 CAAAACTCCTTGGGAAATGGTGG - Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097818381 12:64100613-64100635 CAAGACTTATGGGGAAAAATAGG - Intronic
1097897167 12:64836445-64836467 TAAGACTGCTTTGTAAAAACTGG - Intronic
1097986571 12:65788706-65788728 GAAGACACTTTGGGAAACACTGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1105002599 12:132700986-132701008 CAAAACTCCTTGCGGACAACTGG - Intronic
1106365795 13:29079513-29079535 CAAAACTCTTGGGGAAAAATAGG - Intronic
1106759979 13:32858700-32858722 CAAGACTCCTTGAGGAACAATGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110712692 13:78666664-78666686 CAAAACACAATGGGAAAAACTGG - Intergenic
1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG + Intergenic
1115470541 14:33764362-33764384 CAAGACTAGTTGGGAAACTCAGG + Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117601067 14:57375208-57375230 CAAGACACCCTGGGAAACATAGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120273722 14:82346991-82347013 AAAGTCTCCTTGGGAGAAAAGGG - Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121073895 14:91050899-91050921 CATGAATCCTTTGGTAAAACAGG + Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1123768478 15:23505206-23505228 CAAGACACAATTGGAAAAACTGG - Intergenic
1124044267 15:26134092-26134114 AAAGACTCCTTGGAAACAAATGG + Intergenic
1124630741 15:31335694-31335716 CAAGTCACCTTGGGACAGACTGG - Intronic
1124949269 15:34301510-34301532 CTAGACTTGTTGGGAAAAATTGG - Intronic
1125617271 15:41025971-41025993 CAAGAATACTTTGGAAGAACAGG + Intronic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1130288896 15:82579259-82579281 CAAGACTGCCTGGGCAACACAGG + Intronic
1131588965 15:93727911-93727933 AAAGCAGCCTTGGGAAAAACTGG + Intergenic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136099836 16:27985885-27985907 CACGACTCCTTGAGGAACACAGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138064053 16:53922194-53922216 CAAAACTCTTGGGGAAAAAAAGG - Intronic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1143396774 17:6605519-6605541 GAAGACTCCTAGGGGAAGACAGG - Intronic
1144149484 17:12429621-12429643 CAAGATGCCTTGTGAAACACAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146538659 17:33675418-33675440 CATGATTCCTTGGAACAAACAGG - Intronic
1148439706 17:47705553-47705575 CATGACTGCTTGGGAAGAATGGG - Intronic
1153377878 18:4401216-4401238 CAAAACTCCTTTGTCAAAACGGG + Intronic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155751159 18:29423472-29423494 CAAGAGTCTCTGGGAAAGACCGG - Intergenic
1157095706 18:44683730-44683752 CAAGTCTCCAAGGAAAAAACTGG - Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157347405 18:46852296-46852318 AAAGACTCTTTGGGAAAGGCAGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1161183821 19:2902730-2902752 CAATACTCCTGGTGACAAACTGG - Intronic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1163384815 19:16993191-16993213 CAAGACTCCTTTGGCATAACTGG + Intronic
1165942911 19:39424191-39424213 CAAATCTCCTTGGGCAAAGCTGG - Exonic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167119475 19:47507971-47507993 CAAGGCTCCTTGGGAAAATAAGG + Intronic
1167222237 19:48207595-48207617 GAAAACTCCTTGTGAAAAATGGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925083133 2:1085383-1085405 AAAGACTCCTTAAGAAAAATGGG + Intronic
926734971 2:16066570-16066592 AAAGACTAATTGGGAAAAATGGG + Intergenic
927971470 2:27308225-27308247 GAAGACGCCTTGGGGAACACAGG + Exonic
928161765 2:28933423-28933445 CAAAACTTCTGGGAAAAAACAGG + Intronic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934766319 2:96882099-96882121 CAAGAGTCCTGGGGAAATGCAGG - Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935205711 2:100895157-100895179 CAAGTGTCTTTGGGAGAAACAGG - Intronic
936024019 2:109017433-109017455 CAAGAGACCTTGGGAATCACAGG + Intergenic
936075129 2:109396971-109396993 GAAGCCTTCATGGGAAAAACGGG - Intronic
936149129 2:110002132-110002154 CAAGACCCCTTGAGGAAAGCAGG - Intergenic
936195552 2:110369238-110369260 CAAGACCCCTTGAGGAAAGCAGG + Intergenic
937415125 2:121708595-121708617 CAAGACTCCTTCAAAAAAACAGG - Intergenic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
941296610 2:163746844-163746866 CAAGCCTTCTTGTCAAAAACAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942360069 2:175163412-175163434 CAAGACTGGTAGGGAAAGACAGG - Intronic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
947953303 2:234166138-234166160 CATGACTCTTTGAAAAAAACTGG + Intergenic
948727453 2:239943843-239943865 CAAGACTCCTTGGGGATGAGGGG + Intronic
948998832 2:241600182-241600204 CAAGACTCCTTCTCAAAAAAAGG + Intronic
1171849152 20:30295773-30295795 CAAGAGAACTTGGGAAAAAAGGG + Intergenic
1171948827 20:31402797-31402819 CAAGCTTCTTAGGGAAAAACAGG + Intergenic
1175769275 20:61613129-61613151 CAAGTTTCCTCGGAAAAAACAGG + Intronic
1177240277 21:18446821-18446843 CAAAACTGCTAGAGAAAAACAGG + Intronic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1183177849 22:36237610-36237632 CAAGACAGCTTGGGCAACACAGG - Intronic
1183180125 22:36254361-36254383 CAAGACAGCCTGGGAAACACAGG + Intronic
1183591019 22:38779349-38779371 CAACTCTCCTTGGAAAAACCAGG + Exonic
1184589683 22:45473609-45473631 TAAGGCTACTTGGGAAGAACGGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950396201 3:12736069-12736091 CAAAACCCTGTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG + Intergenic
951316897 3:21198214-21198236 TAAAACTACTAGGGAAAAACAGG - Intergenic
952460340 3:33518185-33518207 CAAAACTCCTTGGTAACCACTGG - Intronic
953776683 3:45823600-45823622 CAAAACTGCTTAGGAAAAAGGGG - Exonic
956554859 3:70508901-70508923 CAAACCTCCTAGGGAAAAAAAGG - Intergenic
956978100 3:74605690-74605712 CAAGCCTCCTTGAGAAACACAGG - Intergenic
959934674 3:112016822-112016844 CAAAGCTCCTTGGAAAACACAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966564053 3:181356362-181356384 CAAGTATATTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
967604636 3:191431002-191431024 TAAGACTCATTTGGAAAATCAGG - Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969517969 4:7659094-7659116 CAAGACTCCCTGGGAACTCCTGG - Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974558635 4:63487730-63487752 CCAGCATCCTGGGGAAAAACTGG - Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975381979 4:73711182-73711204 CAAGACTTCTTGGAAAAATGAGG + Intergenic
976054540 4:81048062-81048084 CAAAAATCCTTGGGAAAGAAGGG - Intronic
976267464 4:83197554-83197576 ACAGACTCCCTGAGAAAAACGGG + Intergenic
976480675 4:85541096-85541118 CAAGACTCCTGGGTCAAAAACGG - Intronic
978790202 4:112655147-112655169 AAAGAATCCTTGGGAAGCACAGG - Intronic
981204248 4:142019976-142019998 GAAGATTGCTTGGGAAAAAGAGG + Intergenic
981662018 4:147178640-147178662 CAAGAATCCATTAGAAAAACTGG + Intergenic
981893662 4:149770091-149770113 CCAGACTCATGGAGAAAAACTGG + Intergenic
982846874 4:160264262-160264284 CAACAGTCCCTGGAAAAAACAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983257609 4:165418204-165418226 CAAGACCCATTGGAAAAATCAGG + Intronic
983459811 4:168014250-168014272 CACTATTCCTTGGGAAAACCAGG - Intergenic
983813329 4:172091512-172091534 AAAATCTCCTTGGGAAAAACTGG - Intronic
985291270 4:188390659-188390681 CAAGACTCCTAGGCTAAAAAAGG - Intergenic
986092457 5:4523601-4523623 CAGGCATCCTTGAGAAAAACAGG + Intergenic
986448876 5:7847615-7847637 CAAGGCTCCTTGGCCAAATCTGG - Intronic
987489306 5:18556260-18556282 AAACAGTCCTTTGGAAAAACTGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991928212 5:71726053-71726075 CAAGATACCTGGGGAAAAAAAGG - Intergenic
994348988 5:98722658-98722680 CAAGCCTCCCTGAGAAAGACAGG - Intergenic
997097044 5:130924507-130924529 CAAGACTCCATCTGAAAAAATGG + Intergenic
1002277873 5:178114879-178114901 CAAGTGTCCTTGGGAGAAACAGG + Intronic
1002539343 5:179895611-179895633 CAAGCCTCCTGGGGTAAAACAGG + Intronic
1004207669 6:13607260-13607282 CAAGAAACCTTGGCAAACACTGG + Intronic
1004437224 6:15607912-15607934 CATGGCTGCTTGTGAAAAACAGG - Intronic
1006331895 6:33397633-33397655 GAAGACTGCTTGGGAGAATCAGG - Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007998642 6:46335561-46335583 CAAGACTGCTTGGGAGAAGGAGG - Intronic
1008021449 6:46582771-46582793 CAAGTCACCTTGTTAAAAACTGG - Intronic
1008373206 6:50760244-50760266 CATTCCTCCTTGGGAAAAAGAGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010550316 6:77213889-77213911 CAAGACTGCTTGGAAAAAAAGGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012493433 6:99808680-99808702 CGAGAGTGCTTGGGAAAAAGAGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1014581909 6:123148098-123148120 CAAGACTGAGTGGGAAAGACAGG - Intergenic
1014941285 6:127442233-127442255 CCAGACTACTTGGGATACACTGG + Exonic
1014954792 6:127601192-127601214 AAAAGCCCCTTGGGAAAAACTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016002087 6:139051902-139051924 CATGACTCCTTGGAAAAAGAGGG + Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017824219 6:158069811-158069833 CAAAACCCCCTAGGAAAAACTGG + Intronic
1018179814 6:161212995-161213017 AAAAACCCCTTGGAAAAAACTGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023762642 7:43480903-43480925 CAGGACTCCTTCTGAAAAAGTGG - Intronic
1023864168 7:44231047-44231069 GAAGACTCCTGAGGAAACACGGG + Exonic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028471722 7:91213222-91213244 TAAGATTCCCTGGGAAAAGCAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029836699 7:103319608-103319630 AAAGGCTGCTTTGGAAAAACAGG - Exonic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031396374 7:121279214-121279236 CAAAAATGCTGGGGAAAAACTGG - Intronic
1031418503 7:121521476-121521498 CAAGATTCCTTGCAAACAACTGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032599806 7:133281371-133281393 AAAGACTCCATGGAAAAAATTGG + Intronic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1038809059 8:30821584-30821606 CCAGACTTCAGGGGAAAAACTGG - Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039939469 8:42077076-42077098 CAAGACAGCTTGGGAAACATAGG + Intergenic
1040064785 8:43136989-43137011 CAAGACGCAATTGGAAAAACTGG + Intergenic
1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG + Intronic
1040568083 8:48584180-48584202 CAAGACTCAAAGGGAAAAATTGG - Intergenic
1041049105 8:53915695-53915717 GAAGACTCCTGGGGAGAACCTGG - Intronic
1042292692 8:67185888-67185910 CAAGAATCCTTCAAAAAAACAGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044327349 8:90874734-90874756 CAACCTTCCATGGGAAAAACAGG + Intronic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1047606137 8:126476589-126476611 GAAGATTTCTTGGGAAAATCAGG - Intergenic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1048644758 8:136407854-136407876 CAAGACTACTTAGCAAGAACAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050760954 9:9070282-9070304 CAAGACGCCTTATGTAAAACTGG - Intronic
1051609474 9:18947358-18947380 CAAGACTCCTTGGTAAACCAAGG - Intronic
1051961218 9:22765088-22765110 GAAGAATCCATGGGAAAAACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053519698 9:38765122-38765144 CAACACTCCTTGGGCACCACTGG + Intergenic
1054952303 9:70866345-70866367 CAATACTCCCTGAGAAAAAGTGG + Intronic
1055528470 9:77159169-77159191 CACAACTGCTTGGGAGAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056710477 9:88988891-88988913 AATGACACCATGGGAAAAACTGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060363591 9:122985187-122985209 AAAGACTCATTTGGAAAAGCAGG + Intronic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1185854453 X:3521106-3521128 CAAGTATCCCTGGGAAAGACTGG + Intergenic
1186000840 X:5008163-5008185 CAATACTCCTTGATAAAAATTGG - Intergenic
1187398120 X:18935571-18935593 CATGATTCCTTGGGATAGACAGG + Intronic
1187468210 X:19544411-19544433 CAAGACTCATAGGTAATAACTGG + Intronic
1187548274 X:20275013-20275035 CAAAACTCCTTGAGAAATACAGG - Intergenic
1187863584 X:23704055-23704077 CAAGACTACTTGGGAACACTGGG + Intronic
1188098485 X:26052126-26052148 CAAGACTTCTAGAGAAAAAAAGG + Intergenic
1188859382 X:35238839-35238861 CATGAATCTTTGGGAAACACTGG + Intergenic
1190540807 X:51476098-51476120 TAAAGCCCCTTGGGAAAAACTGG - Intergenic
1190678972 X:52808207-52808229 AAAGAGTCCTTGTGACAAACAGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193740007 X:85205603-85205625 CAAAAATCCTTAGGAAAAAATGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198198399 X:134388670-134388692 CAAGGCTCTTGGGGAAAAGCTGG - Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200809056 Y:7463398-7463420 CAAGTATCCCTGGGAAAGACTGG - Intergenic