ID: 1190969111

View in Genome Browser
Species Human (GRCh38)
Location X:55331732-55331754
Sequence GTGAACATTAGGAAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190969109_1190969111 -4 Left 1190969109 X:55331713-55331735 CCAGATGGTGGGAGGAATGGTGA No data
Right 1190969111 X:55331732-55331754 GTGAACATTAGGAAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190969111 Original CRISPR GTGAACATTAGGAAGACAAA AGG Intergenic
No off target data available for this crispr