ID: 1190969397

View in Genome Browser
Species Human (GRCh38)
Location X:55334199-55334221
Sequence CTCTATACAGAGATCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190969390_1190969397 23 Left 1190969390 X:55334153-55334175 CCTAGCCAATCCTGTATTATGAG No data
Right 1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG No data
1190969392_1190969397 18 Left 1190969392 X:55334158-55334180 CCAATCCTGTATTATGAGTTGGA No data
Right 1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG No data
1190969389_1190969397 24 Left 1190969389 X:55334152-55334174 CCCTAGCCAATCCTGTATTATGA No data
Right 1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG No data
1190969394_1190969397 13 Left 1190969394 X:55334163-55334185 CCTGTATTATGAGTTGGAGGCAC No data
Right 1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190969397 Original CRISPR CTCTATACAGAGATCCAGGA AGG Intergenic
No off target data available for this crispr