ID: 1190969776

View in Genome Browser
Species Human (GRCh38)
Location X:55337252-55337274
Sequence ATGTATCCACAGAAGTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190969776_1190969777 -9 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969777 X:55337266-55337288 TGGATACATCAAAATCACCTAGG No data
1190969776_1190969780 13 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969780 X:55337288-55337310 GGATTCTAACTTGACAAGCCTGG No data
1190969776_1190969782 15 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969782 X:55337290-55337312 ATTCTAACTTGACAAGCCTGGGG No data
1190969776_1190969778 -8 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969778 X:55337267-55337289 GGATACATCAAAATCACCTAGGG No data
1190969776_1190969781 14 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969781 X:55337289-55337311 GATTCTAACTTGACAAGCCTGGG No data
1190969776_1190969783 23 Left 1190969776 X:55337252-55337274 CCAAACTACTTCTGTGGATACAT No data
Right 1190969783 X:55337298-55337320 TTGACAAGCCTGGGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190969776 Original CRISPR ATGTATCCACAGAAGTAGTT TGG (reversed) Intergenic
No off target data available for this crispr