ID: 1190970093

View in Genome Browser
Species Human (GRCh38)
Location X:55340338-55340360
Sequence ATTAGTCAGCGTTCTCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3409
Summary {0: 22, 1: 909, 2: 1154, 3: 769, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190970093_1190970098 21 Left 1190970093 X:55340338-55340360 CCCTCTAGAGAACGCTGACTAAT 0: 22
1: 909
2: 1154
3: 769
4: 555
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190970093 Original CRISPR ATTAGTCAGCGTTCTCTAGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr