ID: 1190970094

View in Genome Browser
Species Human (GRCh38)
Location X:55340339-55340361
Sequence TATTAGTCAGCGTTCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3514
Summary {0: 22, 1: 931, 2: 1204, 3: 835, 4: 522}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190970094_1190970098 20 Left 1190970094 X:55340339-55340361 CCTCTAGAGAACGCTGACTAATA 0: 22
1: 931
2: 1204
3: 835
4: 522
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190970094 Original CRISPR TATTAGTCAGCGTTCTCTAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr