ID: 1190970097

View in Genome Browser
Species Human (GRCh38)
Location X:55340362-55340384
Sequence TGCATAATAAATAATCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190970097_1190970098 -3 Left 1190970097 X:55340362-55340384 CCTTTGGGATTATTTATTATGCA No data
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190970097 Original CRISPR TGCATAATAAATAATCCCAA AGG (reversed) Intergenic
No off target data available for this crispr