ID: 1190970098

View in Genome Browser
Species Human (GRCh38)
Location X:55340382-55340404
Sequence GCAGCCATGTTAACTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190970093_1190970098 21 Left 1190970093 X:55340338-55340360 CCCTCTAGAGAACGCTGACTAAT 0: 22
1: 909
2: 1154
3: 769
4: 555
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data
1190970094_1190970098 20 Left 1190970094 X:55340339-55340361 CCTCTAGAGAACGCTGACTAATA 0: 22
1: 931
2: 1204
3: 835
4: 522
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data
1190970097_1190970098 -3 Left 1190970097 X:55340362-55340384 CCTTTGGGATTATTTATTATGCA No data
Right 1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190970098 Original CRISPR GCAGCCATGTTAACTGCAAC AGG Intergenic
No off target data available for this crispr