ID: 1190979171

View in Genome Browser
Species Human (GRCh38)
Location X:55440693-55440715
Sequence GGTTGCAGACTGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190979171_1190979179 5 Left 1190979171 X:55440693-55440715 CCCTACTCCATCAGTCTGCAACC No data
Right 1190979179 X:55440721-55440743 CCACTCTTGGCTTCATGATAAGG No data
1190979171_1190979174 -8 Left 1190979171 X:55440693-55440715 CCCTACTCCATCAGTCTGCAACC No data
Right 1190979174 X:55440708-55440730 CTGCAACCACACCCCACTCTTGG No data
1190979171_1190979181 11 Left 1190979171 X:55440693-55440715 CCCTACTCCATCAGTCTGCAACC No data
Right 1190979181 X:55440727-55440749 TTGGCTTCATGATAAGGGCATGG No data
1190979171_1190979182 12 Left 1190979171 X:55440693-55440715 CCCTACTCCATCAGTCTGCAACC No data
Right 1190979182 X:55440728-55440750 TGGCTTCATGATAAGGGCATGGG No data
1190979171_1190979180 6 Left 1190979171 X:55440693-55440715 CCCTACTCCATCAGTCTGCAACC No data
Right 1190979180 X:55440722-55440744 CACTCTTGGCTTCATGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190979171 Original CRISPR GGTTGCAGACTGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr