ID: 1190980132

View in Genome Browser
Species Human (GRCh38)
Location X:55450040-55450062
Sequence ATAGAGGAGCACAGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190980127_1190980132 3 Left 1190980127 X:55450014-55450036 CCATGGGCATAATTGCTGACTTC No data
Right 1190980132 X:55450040-55450062 ATAGAGGAGCACAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190980132 Original CRISPR ATAGAGGAGCACAGTGGGGA AGG Intergenic
No off target data available for this crispr