ID: 1190980402

View in Genome Browser
Species Human (GRCh38)
Location X:55452470-55452492
Sequence GACCCCTATGGCCGCCTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190980397_1190980402 -2 Left 1190980397 X:55452449-55452471 CCAGGCCTCAGAGGCCTCCGAGA 0: 1
1: 0
2: 3
3: 26
4: 283
Right 1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 86
1190980398_1190980402 -7 Left 1190980398 X:55452454-55452476 CCTCAGAGGCCTCCGAGACCCCT 0: 1
1: 0
2: 0
3: 26
4: 246
Right 1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 86
1190980394_1190980402 16 Left 1190980394 X:55452431-55452453 CCGCAACAATCGCAAAATCCAGG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 86
1190980393_1190980402 29 Left 1190980393 X:55452418-55452440 CCGCAGAAGAGAACCGCAACAAT 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190980402 Original CRISPR GACCCCTATGGCCGCCTCTG TGG Exonic
900532756 1:3162785-3162807 GACCTCTCTGGCTGCCTGTGTGG - Intronic
900678246 1:3901504-3901526 GTCCTCTTTGGCCGCCGCTGAGG + Intergenic
901806325 1:11740913-11740935 GACCACTGTGGCTGACTCTGCGG + Intronic
902691001 1:18110076-18110098 AATCCCTTTGCCCGCCTCTGCGG + Intronic
904675219 1:32195055-32195077 GGCCCCTCTGGCCTCCTCTCAGG - Exonic
906108297 1:43307518-43307540 GACCCCTATGGCTGCTCTTGTGG + Exonic
910963547 1:92785494-92785516 GTGCCCTAAGGCCACCTCTGGGG - Intronic
915560033 1:156681712-156681734 CACCCCTGTGGCCCCCTCTGAGG - Intergenic
915667039 1:157454467-157454489 TACCCCTATGCCAACCTCTGGGG - Intergenic
916716163 1:167448361-167448383 GACCCCTCTCACCACCTCTGAGG - Intronic
919403279 1:197146528-197146550 GACCTCTACAGCCGCCCCTGAGG - Exonic
923007904 1:230067038-230067060 GACCCCCCTCGCCGCCTCCGAGG + Intronic
1062871455 10:908436-908458 GATCCCCATGGCCCCCTCTTTGG - Intronic
1067802784 10:49370597-49370619 AGCCCCTTTGGCAGCCTCTGAGG - Intronic
1074843413 10:117375986-117376008 GTCCGCGATGGCTGCCTCTGAGG - Intergenic
1077034974 11:490176-490198 CAACCCTCTGGCCGCCTCTGCGG + Intronic
1077119158 11:898882-898904 GACCGCCATGGCGGCCTCTGGGG - Intronic
1082188010 11:49208167-49208189 GACCCTAATCGCCGCCCCTGGGG + Intronic
1085020707 11:73205072-73205094 GAACCCTATGGACGTCTCTCTGG - Intergenic
1085059105 11:73428184-73428206 CACCCCTACAGCAGCCTCTGTGG + Intronic
1089046099 11:115503538-115503560 GGCCGCTGTCGCCGCCTCTGCGG - Intronic
1098302317 12:69066974-69066996 GACCTTTATGGGCCCCTCTGAGG + Intergenic
1104941855 12:132398945-132398967 CATCCCTGTAGCCGCCTCTGAGG - Intergenic
1108381147 13:49855584-49855606 GTTCCCTATGGGAGCCTCTGAGG - Intergenic
1113976205 13:114229336-114229358 GACGCTTATGGCCCCGTCTGTGG + Intergenic
1118475516 14:66112635-66112657 GACTCCTGTGGCCACCTCAGTGG + Intergenic
1119970168 14:78961398-78961420 GACCCCTCTGGTAGCCACTGGGG + Intronic
1122690212 14:103528725-103528747 GACCCCTTTGACGGCCCCTGGGG - Intergenic
1122738716 14:103858553-103858575 GACCCGTCTGGCAGCCCCTGAGG + Intergenic
1122961575 14:105096304-105096326 GACCCCTGGGTCTGCCTCTGTGG - Intergenic
1129704846 15:77788244-77788266 GCCCCCTATAACCCCCTCTGCGG + Intronic
1132803717 16:1766265-1766287 GGCCTCTGTGGCCTCCTCTGTGG - Exonic
1132973771 16:2701521-2701543 CACCCCTGTGGCCGCCTCACTGG + Intronic
1136381448 16:29897916-29897938 GACCCCCACGGTGGCCTCTGAGG - Exonic
1136620341 16:31424243-31424265 GACCCCTAGGGCTACATCTGTGG + Intronic
1139650945 16:68361786-68361808 GGCCCCCATGCCCGCCCCTGTGG + Intronic
1142154061 16:88525218-88525240 GACCCCACTGCCCACCTCTGCGG + Intronic
1142185543 16:88693191-88693213 GTCCCCCATGGAGGCCTCTGGGG + Intergenic
1150431682 17:65123240-65123262 AACCCCTAATGCCGACTCTGGGG - Intergenic
1151834171 17:76572554-76572576 GAGCCCTGTGGCCCCCACTGAGG + Intronic
1151950598 17:77351592-77351614 GGGCCCTGGGGCCGCCTCTGAGG - Intronic
1153749310 18:8212296-8212318 CACCTGTATTGCCGCCTCTGGGG - Intronic
1156997237 18:43482739-43482761 GGCCCCTAAGCCCGCCCCTGAGG - Intergenic
1158319670 18:56248999-56249021 GACTCTTATGGCTCCCTCTGGGG - Intergenic
1160752917 19:743156-743178 GACCCCTCTGACAGCATCTGGGG - Intronic
1160949924 19:1661237-1661259 GACGCCTGAGGCCGCCTCTCTGG + Intergenic
1161619387 19:5290388-5290410 GAGCCCGCTGGCCGCCTCTGGGG + Intronic
1161954362 19:7484792-7484814 GACCACAGTGGCTGCCTCTGTGG + Intronic
1162205795 19:9055089-9055111 TGCCCCTAGGGCTGCCTCTGTGG - Intergenic
1162439123 19:10681899-10681921 AACCCCCAGGGCTGCCTCTGTGG - Intronic
1163621703 19:18364719-18364741 GACCCCCATGGCCACATCTGGGG - Exonic
1165312055 19:35034334-35034356 GACCCCTAGGCCCGCCCCAGAGG - Intronic
1165375301 19:35437618-35437640 GTCCCCCATGTCCTCCTCTGTGG + Intergenic
925203934 2:1990924-1990946 GACCCAGATGGCCGCCTGTGAGG - Intronic
935946299 2:108289609-108289631 GATCACTATGGCCTCCTTTGTGG - Intronic
938422020 2:131153719-131153741 GACCCCTAGGGAGGACTCTGGGG + Intronic
942047234 2:172106858-172106880 GACCCCTAAGGCAGCCTCGAGGG + Intergenic
946148587 2:217749085-217749107 GACTCCAGTGGCAGCCTCTGGGG - Intronic
947929615 2:233952770-233952792 GACTCCTGTGGCCGTCTCTGGGG + Intronic
948501970 2:238401897-238401919 GACCACTGTGGGCTCCTCTGAGG + Intergenic
948889974 2:240902832-240902854 GACACCCATGGCCGGCTGTGTGG + Intergenic
948963377 2:241356795-241356817 GGTCCCTATGGCCCACTCTGGGG - Intronic
1168902396 20:1376106-1376128 CACCCCCATGGGCTCCTCTGTGG + Intronic
1179833437 21:44012487-44012509 GACGCCCATGGACGCCTCTGAGG + Exonic
1181085209 22:20436648-20436670 GAGCCCGGCGGCCGCCTCTGCGG + Intronic
1184503692 22:44888748-44888770 GACCTCTGAGGCCTCCTCTGAGG - Intronic
1185126597 22:49014669-49014691 GGCCCGTCTGGCCCCCTCTGAGG + Intergenic
950936189 3:16842036-16842058 GACGCCTGTGGCAGCATCTGTGG + Intronic
958816008 3:98916272-98916294 GACCCCTGTGGCTCTCTCTGTGG - Intergenic
968899498 4:3424494-3424516 TGCCCCTCTGGCCGACTCTGGGG + Intronic
988132355 5:27121180-27121202 GAGCCAGATGGCCCCCTCTGGGG + Intergenic
997195204 5:131974632-131974654 GACCCCTATGGTACCTTCTGAGG + Intronic
997963284 5:138338414-138338436 GGCCTCGCTGGCCGCCTCTGCGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003403876 6:5812162-5812184 GAGCCCTGAGGCTGCCTCTGAGG - Intergenic
1007170660 6:39861029-39861051 GACCCCTCTGGCCACATCTCAGG + Intronic
1007810624 6:44483164-44483186 GACCCCTCTAGCCTCCTCTGGGG + Intergenic
1019320643 7:414019-414041 GAGCCCAAAGGCAGCCTCTGTGG - Intergenic
1021947611 7:25743572-25743594 GAAGCCTTTGGCCACCTCTGTGG + Intergenic
1023355038 7:39357869-39357891 GCCCCCTCTGGTGGCCTCTGAGG + Intronic
1024233506 7:47380408-47380430 AAGCTCTCTGGCCGCCTCTGTGG - Intronic
1032848206 7:135769857-135769879 TACCACTATGGCCTCCTCTCAGG - Intergenic
1036687642 8:10922651-10922673 GACTCCCATGGCCGCAGCTGTGG + Intronic
1043573458 8:81630766-81630788 AACCCCTGTGGCAGCTTCTGTGG - Intergenic
1044648940 8:94474713-94474735 GGCCCCTGGGGCCGCCACTGCGG - Intronic
1048270141 8:133021885-133021907 GACTCCTCTGGCCAGCTCTGTGG - Intronic
1048441369 8:134461979-134462001 GACCCCTCGGGCTGCCTCTGAGG + Intergenic
1049804344 8:144532224-144532246 GGCCCCTGTCTCCGCCTCTGGGG - Intronic
1054455910 9:65430314-65430336 GACCCCTCTGGCTGCTGCTGGGG - Intergenic
1058574656 9:106387511-106387533 GACCCCTGCGACCGCCTATGAGG - Intergenic
1060823254 9:126673409-126673431 GACCCCACTGGCCTCCTGTGCGG - Intronic
1060883610 9:127135552-127135574 GACCCATATCACCACCTCTGTGG + Intronic
1061806409 9:133139869-133139891 TACCCCCATTGCCTCCTCTGTGG - Intronic
1061864442 9:133485150-133485172 GGCCCCTATGGCAGCCCCCGTGG - Intergenic
1062194826 9:135267159-135267181 CACCCCTAAGGAGGCCTCTGGGG - Intergenic
1190265029 X:48823128-48823150 TCCCCCTGTGGCTGCCTCTGAGG - Exonic
1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG + Exonic