ID: 1190993044

View in Genome Browser
Species Human (GRCh38)
Location X:55572394-55572416
Sequence AAACTACCGCAGGAACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190993041_1190993044 -9 Left 1190993041 X:55572380-55572402 CCATTATCCTCAGCAAACTACCG No data
Right 1190993044 X:55572394-55572416 AAACTACCGCAGGAACAGAAAGG No data
1190993040_1190993044 21 Left 1190993040 X:55572350-55572372 CCTTTGCTGGGACATTGATGGAG No data
Right 1190993044 X:55572394-55572416 AAACTACCGCAGGAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190993044 Original CRISPR AAACTACCGCAGGAACAGAA AGG Intergenic
No off target data available for this crispr